Preparing cDNA Libraries from Lytic Phage-Infected Cells for Whole Transcriptome Analysis by RNA-Seq.

Entire genome large evaluation of transcription utilizing RNA-Seq strategies is a strong strategy to elucidate differential expression of gene options in micro organism throughout completely different circumstances in addition to for locating beforehand unique RNA species.

Certainly, RNA sequencing has revolutionized the examine of bacterial transcription with the range and amount of small noncoding RNA parts which were discovered and its capability to obviously outline operons, promoters , and terminators . We focus on our expertise with making use of RNA sequencing know-how to analyzing the lytic cycle, together with extraction, processing, and a information to the custom-made statistical evaluation needed for analyzing differential host and phage transcription.

Speedy Development of Advanced Plant RNA Virus Infectious cDNA Clones for Agroinfection Utilizing a Yeast-E. coli-Agrobacterium Shuttle Vector.

The provision of infectious full-length clone is indispensable for reverse genetics research of virus biology, pathology and development of viral vectors. Nevertheless, for RNA viruses with giant genome sizes or these exhibiting inherent cloning difficulties, process to generate biologically lively round DNA (cDNA) clones will be time-consuming or technically difficult. Right here we have now constructed a yeast-Escherichia coli-Agrobacterium shuttle vector that permits extremely environment friendly homologous recombination in yeast for meeting of Agrobacterium suitable plant virus clones. Utilizing this vector, we present that infectious cDNA clones of a plant negative-stranded RNA virus, sonchus yellow web rhabdovirus, will be quickly assembled. As well as, one-step meeting of infectious clones of potato virus Y in yeast, both with or with out intron, was readily achieved from as many as eight overlapping DNA fragments.

Extra importantly, the recovered yeast plasmids will be remodeled immediately into Agrobacterium for inoculation, thereby obviating the E. coli cloning steps and related toxicity points. This technique is speedy, extremely environment friendly and cost-effective and needs to be readily relevant to a broad vary of plant viruses.

3′ RNA ligase mediated speedy amplification of cDNA ends for validating viroid induced cleavage on the 3′ extremity of the host mRNA.

5′ RNA ligase-mediated speedy amplification of cDNA ends (5′ RLM-RACE) is a widely-accepted technique for the validation of direct cleavage of a goal gene by a microRNA (miRNA) and viroid-derived small RNA (vd-sRNA). Nevertheless, this technique can’t be used if cleavage takes place within the 3′ extremity of the goal RNA, as this offers inadequate sequence size to design nested PCR primers for five’ RLM RACE. To beat this hurdle, we have now developed 3′ RNA ligase-mediated speedy amplification of cDNA ends (3′ RLM RACE).

On this technique, an oligonucleotide adapter having 5′ adenylated and three’ blocked is ligated to the three’ finish of the cleaved RNA adopted by PCR amplification utilizing gene particular primers. In different phrases, in 3′ RLM RACE, 3′ finish is mapped utilizing 5′ fragment as a substitute of small 3′ fragment.

Preparing cDNA Libraries from Lytic Phage-Infected Cells for Whole Transcriptome Analysis by RNA-Seq.

The strategy developed right here was verified by inspecting the bioinformatics predicted and parallel evaluation of RNA ends (PARE) proved cleavage websites of chloride channel protein CLC-b-like mRNA in Potato spindle tuber viroid contaminated tomato vegetation. The three’ RLM RACE developed on this examine has the potential to validate the miRNA and vd-sRNA mediated cleavage of mRNAs at its 3′ untranslated area (3′ UTR).

Stimulation of reverse transcriptase generated cDNAs with particular indels by template RNA construction: retrotransposon, dNTP steadiness, RT-reagent utilization.

RNA dependent DNA-polymerases, reverse transcriptases, are key enzymes for retroviruses and retroelements. Their constancy, together with indel technology, is important for his or her use as reagents together with for deep sequencing. Right here, we report that sure RNA template buildings and G-rich sequences, forward of numerous reverse transcriptases will be sturdy stimulators for slippage at slippage-prone template motif sequence 3′ of such ‘slippage-stimulatory’ buildings. The place slippage is stimulated, the ensuing merchandise have a number of extra base(s) in comparison with the corresponding template motif.

Such buildings additionally inhibit slippage-mediated base omission which will be extra frequent within the absence of a related stem-loop. Slippage directionality, base insertion and omission, is delicate to the relative focus ratio of dNTPs specified by the RNA template slippage-prone sequence and its 5′ adjoining base. The retrotransposon-derived enzyme TGIRT reveals extra slippage in vitro than the retroviral enzymes examined together with that from HIV.

Construction-mediated slippage could also be exhibited by different polymerases and enrich gene expression. A cassette from Drosophila retrotransposon Dme1_chrX_2630566, a candidate for using slippage for its GagPol synthesis, reveals sturdy slippage in vitro. Given the widespread incidence and significance of retrotransposons, systematic research to disclose the extent of their purposeful utilization of RT slippage are merited.

In Vitro Synthesized RNA Generated from cDNA Clones of Each Genomic Elements of Cucurbit yellow stunting dysfunction virus Replicates in Cucumber Protoplasts.

Cucurbit yellow stunting dysfunction virus (CYSDV), a bipartite whitefly-transmitted virus, constitutes a serious risk to industrial cucurbit manufacturing worldwide. Right here, development of full-length CYSDV RNA1 and RNA2 cDNA clones allowed the in vitro synthesis of RNA transcripts in a position to replicate in cucumber protoplasts. CYSDV RNA1 proved competent for replication; transcription of each polarities of the genomic RNA was detectable 24 h submit inoculation.

Hybridization of complete RNA extracted from transfected protoplasts or from naturally CYSDV-infected cucurbits revealed high-level transcription of the p22 subgenomic RNA species. Replication of CYSDV RNA2 following co-transfection with RNA1 was additionally noticed, with comparable transcription kinetics. A CYSDV RNA2 cDNA clone (T3CM8Δ) comprising the 5′- and three’-UTRs plus the three’-terminal gene, generated a 2.eight kb RNA in a position to replicate to excessive ranges in protoplasts within the presence of CYSDV RNA1. The clone T3CM8Δ will facilitate reverse genetics research of CYSDV gene operate and RNA replication determinants.

A single-plasmid reverse genetics system for the rescue of non-segmented negative-strand RNA viruses from cloned full-length cDNA.

Reverse genetics techniques for non-segmented negative-strand RNA viruses depend on co-transfection of a plasmid containing the full-length viral cDNA and helper plasmids encoding important viral replication proteins. Right here, a system is offered wherein virus will be rescued from a single plasmid with out the necessity for helper plasmids in cells contaminated with a host-restricted recombinant poxvirus that expresses T7 RNA polymerase.

Human Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3) ELISA Kit

RD-CHRNa3-Hu-48Tests 48 Tests
EUR 521

Human Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3) ELISA Kit

RD-CHRNa3-Hu-96Tests 96 Tests
EUR 723

Chrna3/ Rat Chrna3 ELISA Kit

ELI-49491r 96 Tests
EUR 886

CHRNA3 antibody

20R-1327 100 ug
EUR 377
Description: Rabbit polyclonal CHRNA3 antibody

CHRNA3 Antibody

31245-100ul 100ul
EUR 252

CHRNA3 Antibody

31245-50ul 50ul
EUR 187

CHRNA3 antibody

70R-16408 50 ul
EUR 435
Description: Rabbit polyclonal CHRNA3 antibody

CHRNA3 antibody

70R-10537 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CHRNA3 antibody

CHRNA3 Antibody

1-CSB-PA005389GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CHRNA3. Recognizes CHRNA3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CHRNA3 Antibody

1-CSB-PA000802
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CHRNA3. Recognizes CHRNA3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

CHRNA3 Antibody

1-CSB-PA085715
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CHRNA3. Recognizes CHRNA3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:25-1:100

CHRNA3 protein

80R-4244 100 ug
EUR 349
Description: Recombinant Human CHRNA3 protein with His tag

CHRNA3 antibody

70R-49550 100 ul
EUR 244
Description: Purified Polyclonal CHRNA3 antibody

CHRNA3 antibody

70R-5188 50 ug
EUR 467
Description: Rabbit polyclonal CHRNA3 antibody raised against the N terminal of CHRNA3

CHRNA3 siRNA

20-abx911778
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CHRNA3 siRNA

20-abx911779
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CHRNA3 Blocking Peptide

33R-2458 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CHRNA3 antibody, catalog no. 70R-5188

CHRNA3 Blocking Peptide

33R-7520 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CHRNA3 antibody, catalog no. 20R-1327

CHRNA3 Blocking Peptide

20-abx062425
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CHRNA3 Conjugated Antibody

C31245 100ul
EUR 397

CHRNA3 cloning plasmid

CSB-CL005389HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1518
  • Sequence: atgggctctggcccgctctcgctgcccctggcgctgtcgccgccgcggctgctgctgctgctgctgctgtctctgctgccagtggccagggcctcagaggctgagcaccgtctatttgagcggctgtttgaagattacaatgagatcatccggcctgtagccaacgtgtctgacc
  • Show more
Description: A cloning plasmid for the CHRNA3 gene.

CHRNA3 cloning plasmid

CSB-CL005389HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1470
  • Sequence: atgggctctggcccgctctcgctgcccctggcgctgtcgccgccgcggctgctgctgctgctgctgctgtctctgctgccagtggccagggcctcagaggctgagcaccgtctatttgagcggctgtttgaagattacaatgagatcatccggcctgtagccaacgtgtctgacc
  • Show more
Description: A cloning plasmid for the CHRNA3 gene.

CHRNA3 Rabbit pAb

A1674-100ul 100 ul
EUR 308

CHRNA3 Rabbit pAb

A1674-200ul 200 ul
EUR 459

CHRNA3 Rabbit pAb

A1674-20ul 20 ul
EUR 183

CHRNA3 Rabbit pAb

A1674-50ul 50 ul
EUR 223

anti- CHRNA3 antibody

FNab01676 100µg
EUR 548.75
  • Immunogen: cholinergic receptor, nicotinic, alpha 3
  • Uniprot ID: P32297
  • Gene ID: 1136
  • Research Area: Neuroscience, Signal Transduction, Developmental biology
Description: Antibody raised against CHRNA3

Anti-CHRNA3 antibody

PAab01676 100 ug
EUR 386

pOTB7-CHRNA3 Plasmid

PVTB00094S 2 ug
EUR 356

Anti-CHRNA3 antibody

STJ111103 100 µl
EUR 277
Description: This locus encodes a member of the nicotinic acetylcholine receptor family of proteins. Members of this family of proteins form pentameric complexes comprised of both alpha and beta subunits. This locus encodes an alpha-type subunit, as it contains characteristic adjacent cysteine residues. The encoded protein is a ligand-gated ion channel that likely plays a role in neurotransmission. Polymorphisms in this gene have been associated with an increased risk of smoking initiation and an increased susceptibility to lung cancer. Alternatively spliced transcript variants have been described.

Recombinant Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3)

4-RPD143Hu01
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P32297
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Cholinergic Receptor, Nicotinic, Alpha 3 expressed in: E.coli

Mouse Chrna3 ELISA KIT

ELI-11878m 96 Tests
EUR 865

Chicken CHRNA3 ELISA KIT

ELI-24546c 96 Tests
EUR 928

CHRNA3 ELISA KIT|Human

EF008656 96 Tests
EUR 689

Mouse CHRNA3 shRNA Plasmid

20-abx980106
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CHRNA3 shRNA Plasmid

20-abx950813
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Bovine CHRNA3 ELISA KIT

ELI-49438b 96 Tests
EUR 928

Human CHRNA3 ELISA KIT

ELI-49490h 96 Tests
EUR 824

pcDNA3.1(+)-CHRNA3(P229H) Plasmid

PVTB00094-2a 2 ug
EUR 356

CHRNA3 Recombinant Protein (Human)

RP007060 100 ug Ask for price

CHRNA3 Recombinant Protein (Human)

RP007063 100 ug Ask for price

CHRNA3 Recombinant Protein (Rat)

RP194945 100 ug Ask for price

CHRNA3 Recombinant Protein (Mouse)

RP124064 100 ug Ask for price

Human Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3) ELISA Kit

SED143Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3) in Tissue homogenates and other biological fluids.

Human Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3) ELISA Kit

SED143Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3) in Tissue homogenates and other biological fluids.

Human Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3) ELISA Kit

SED143Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3) in Tissue homogenates and other biological fluids.

Human Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3) ELISA Kit

SED143Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3) in Tissue homogenates and other biological fluids.

Human Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3) ELISA Kit

4-SED143Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Cholinergic Receptor, Nicotinic, Alpha 3 elisa. Alternative names of the recognized antigen: CHR-NA3
  • CHRN-A3
  • N-AChRA3
  • NAChRA3
  • N-AChR-A3
  • Neuronal Acetylcholine Receptor Alpha 3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Chrna3 ORF Vector (Rat) (pORF)

ORF064983 1.0 ug DNA
EUR 506

CHRNA3 ORF Vector (Human) (pORF)

ORF002354 1.0 ug DNA
EUR 95

CHRNA3 ORF Vector (Human) (pORF)

ORF002355 1.0 ug DNA
EUR 95

Chrna3 ORF Vector (Mouse) (pORF)

ORF041356 1.0 ug DNA
EUR 506

pECMV-Chrna3-m-FLAG Plasmid

PVT14993 2 ug
EUR 325

CHRNA3 ELISA Kit (Human) (OKCD00894)

OKCD00894 96 Wells
EUR 831
Description: Description of target: After binding acetylcholine, the AChR responds by an extensive change in conformation that affects all subunits and leads to opening of an ion-conducting channel across the plasma membrane. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.107 ng/mL

cDNA Synthesis SuperMix

20-abx09801420ulSystems
  • EUR 565.00
  • EUR 481.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

Evo? cDNA Kit

M1164-100
EUR 294

Evo? cDNA Kit

M1164-25
EUR 234

Novo? cDNA Kit

M1165-100
EUR 354

Novo? cDNA Kit

M1165-25
EUR 267

Evo? cDNA Supermix

M1168-100
EUR 381

Evo? cDNA Supermix

M1168-25
EUR 267

Novo? cDNA Supermix

M1169-100
EUR 441

Novo? cDNA Supermix

M1169-25
EUR 289

Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3) Polyclonal Antibody (Human, Mouse)

4-PAD143Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHRNa3 (Ser32~Leu240)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3)

cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis

C1634310 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Corn

C1634330 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Orange

C1634340 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Potato

C1634350 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Rice

C1634360 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Wheat

C1634390 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3) Polyclonal Antibody (Human, Mouse), APC

4-PAD143Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHRNa3 (Ser32~Leu240)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3). This antibody is labeled with APC.

Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3) Polyclonal Antibody (Human, Mouse), Biotinylated

4-PAD143Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHRNa3 (Ser32~Leu240)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3). This antibody is labeled with Biotin.

Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3) Polyclonal Antibody (Human, Mouse), Cy3

4-PAD143Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHRNa3 (Ser32~Leu240)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3). This antibody is labeled with Cy3.

Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3) Polyclonal Antibody (Human, Mouse), FITC

4-PAD143Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHRNa3 (Ser32~Leu240)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3). This antibody is labeled with FITC.

Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3) Polyclonal Antibody (Human, Mouse), HRP

4-PAD143Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHRNa3 (Ser32~Leu240)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3). This antibody is labeled with HRP.

Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3) Polyclonal Antibody (Human, Mouse), PE

4-PAD143Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHRNa3 (Ser32~Leu240)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3). This antibody is labeled with PE.

CHRNA3 sgRNA CRISPR Lentivector set (Human)

K0448801 3 x 1.0 ug
EUR 339

Chrna3 sgRNA CRISPR Lentivector set (Rat)

K6844801 3 x 1.0 ug
EUR 339

Chrna3 sgRNA CRISPR Lentivector set (Mouse)

K3739501 3 x 1.0 ug
EUR 339

First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)

20-abx09801620ulSystems
  • EUR 620.00
  • EUR 523.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)

20-abx09802120ulSystems
  • EUR 871.00
  • EUR 662.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean

C1634370 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA Probe Diluent Solution

AR0063 5mL
EUR 106

cDNA from Arteriosclerosis: Aorta

C1236012Hd-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Artery

C1236013Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Arteriosclerosis: Artery

C1236013Hd-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Vein

C1236020Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Colon

C1236090Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart

C1236122Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Heart

C1236122Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Kidney

C1236142Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Kidney

C1236142Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Liver

C1236149Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Asthma: Lung

C1236152Ld-1 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Bronchitis: Lung

C1236152Ld-2 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Emphysema: Lung

C1236152Ld-3 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Pneumonia: Lung

C1236152Ld-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Lung

C1236152Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Pancreas

C1236188Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Spleen

C1236246Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: stomach

C1236248Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Tetro cDNA Synthesis Kit

BIO-65042 30 Reactions Ask for price

Tetro cDNA Synthesis Kit

BIO-65043 100 Reactions Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65053 50 Reactions Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65053/S Sample Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65054 250 Reactions Ask for price

OneScriptPlus cDNA Synthesis Kit

G235 25 x 20 ul reactions
EUR 97

OneScriptPlus cDNA Synthesis Kit

G236 100 x 20 ul reactions
EUR 169

OneScriptPlus cDNA Synthesis SuperMix

G453 25 x 20 ul reactions
EUR 97

OneScriptPlus cDNA Synthesis SuperMix

G454 100 x 20 ul reactions
EUR 169

circRNA cDNA Synthesis Kit

G627 25 rxn (20 ul/rxn)
EUR 309

Human eNOS cDNA probe

eNOS51-D-2 2 ug
EUR 445

Novo? Transcriptome cDNA Kit

M1167-100
EUR 952

Novo? Transcriptome cDNA Kit

M1167-25
EUR 441

Plant Tissue cDNA: Arabidopsis

PC34-310 10 rxn
EUR 415

Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3) Polyclonal Antibody (Human, Mouse), APC-Cy7

4-PAD143Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHRNa3 (Ser32~Leu240)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3). This antibody is labeled with APC-Cy7.

Cholinergic Receptor, Nicotinic Alpha 3 (CHRNA3) Antibody

20-abx009435
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNA3) Antibody

20-abx111610
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cholinergic Receptor, Nicotinic Alpha 3 (CHRNA3) Antibody

20-abx123004
  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cholinergic Receptor, Nicotinic Alpha 3 (CHRNA3) Antibody

20-abx125675
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3) Antibody

20-abx130886
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNa3) Antibody

20-abx171728
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Cholinergic Receptor, Nicotinic Alpha 3 (CHRNA3) Antibody

abx032382-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Cholinergic Receptor, Nicotinic Alpha 3 (CHRNA3) Antibody

abx032382-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNA3) Antibody

20-abx241009
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cholinergic Receptor, Nicotinic, Alpha 3 (CHRNA3) Antibody

20-abx327182
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cholinergic Receptor, Nicotinic Alpha 3 (CHRNA3) Antibody

abx231676-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

CHRNA3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0448802 1.0 ug DNA
EUR 154

CHRNA3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0448803 1.0 ug DNA
EUR 154

CHRNA3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0448804 1.0 ug DNA
EUR 154

Chrna3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6844802 1.0 ug DNA
EUR 154

Chrna3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6844803 1.0 ug DNA
EUR 154

Chrna3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6844804 1.0 ug DNA
EUR 154

Chrna3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3739502 1.0 ug DNA
EUR 154

Chrna3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3739503 1.0 ug DNA
EUR 154

Chrna3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3739504 1.0 ug DNA
EUR 154

CHRNA3 Protein Vector (Mouse) (pPB-C-His)

PV165422 500 ng
EUR 603

CHRNA3 Protein Vector (Mouse) (pPB-N-His)

PV165423 500 ng
EUR 603

CHRNA3 Protein Vector (Mouse) (pPM-C-HA)

PV165424 500 ng
EUR 603

CHRNA3 Protein Vector (Mouse) (pPM-C-His)

PV165425 500 ng
EUR 603

CHRNA3 Protein Vector (Rat) (pPB-C-His)

PV259930 500 ng
EUR 603

CHRNA3 Protein Vector (Rat) (pPB-N-His)

PV259931 500 ng
EUR 603

CHRNA3 Protein Vector (Rat) (pPM-C-HA)

PV259932 500 ng
EUR 603

CHRNA3 Protein Vector (Rat) (pPM-C-His)

PV259933 500 ng
EUR 603

CHRNA3 Protein Vector (Human) (pPB-C-His)

PV009413 500 ng
EUR 329

CHRNA3 Protein Vector (Human) (pPB-N-His)

PV009414 500 ng
EUR 329

CHRNA3 Protein Vector (Human) (pPM-C-HA)

PV009415 500 ng
EUR 329

CHRNA3 Protein Vector (Human) (pPM-C-His)

PV009416 500 ng
EUR 329

CHRNA3 Protein Vector (Human) (pPB-C-His)

PV009417 500 ng
EUR 329

CHRNA3 Protein Vector (Human) (pPB-N-His)

PV009418 500 ng
EUR 329

CHRNA3 Protein Vector (Human) (pPM-C-HA)

PV009419 500 ng
EUR 329

CHRNA3 Protein Vector (Human) (pPM-C-His)

PV009420 500 ng
EUR 329

Chrna3 3'UTR GFP Stable Cell Line

TU153869 1.0 ml Ask for price

Chrna3 3'UTR Luciferase Stable Cell Line

TU103869 1.0 ml Ask for price

Chrna3 3'UTR Luciferase Stable Cell Line

TU202321 1.0 ml Ask for price

Chrna3 3'UTR GFP Stable Cell Line

TU252321 1.0 ml Ask for price

CHRNA3 3'UTR GFP Stable Cell Line

TU054393 1.0 ml
EUR 1521

CHRNA3 3'UTR Luciferase Stable Cell Line

TU004393 1.0 ml
EUR 1521

cDNA Synthesis SuperMix for qPCR

20-abx09801920ulSystems
  • EUR 690.00
  • EUR 565.00
  • 100 rxns ×20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

cDNA from Alzheimer's Disease: Brain

C1236035Alz 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Brain

C1236035Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Parkinson's Disease: Brain

C1236035Par 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Dementia: Brain: Hippocampus

C1236052Dem 40 reactions
EUR 801
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Depression: Brain: Hippocampus

C1236052Dep 40 reactions
EUR 801
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Colon

C1236090Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Esophagus

C1236106Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

This method depends on the insertion of T7 promoter sequences within the viral cDNA at positions that enable transcription of sub-genomic RNAs encoding important viral replication proteins.

Leave a Comment