Purification of Single-Stranded cDNA Based on RNA Degradation Treatment and Adsorption Chromatography.

Purification of Single-Stranded cDNA Based on RNA Degradation Treatment and Adsorption Chromatography.

Evaluation of gene expression is a standard analysis instrument to check networks controlling gene expression, the position of genes with unknown perform, and environmentally induced responses of organisms. A lot of the analytical instruments used to investigate gene expression depend on correct cDNA synthesis and quantification to acquire reproducible and quantifiable outcomes. So far, most business kits for isolation and purification of cDNA goal double-stranded molecules, which don’t precisely characterize the abundance of transcripts.

Within the current report, we offer a easy and quick technique to purify single-stranded cDNA, exhibiting excessive purity and yield. This technique is predicated on the therapy with RNase H and RNase A after cDNA synthesis, adopted by separation in silica spin-columns and ethanol precipitation. As well as, our technique avoids the usage of DNase I to get rid of genomic DNA from RNA preparations, which improves cDNA yield. As a case report, our technique proved to be helpful within the purification of single-stranded cDNA from the pathogenic fungus Sporothrix schenckii.

Destiny of HIV-1 cDNA intermediates throughout reverse transcription is dictated by transcription initiation web site of virus genomic RNA.

Retroviral reverse transcription is completed by sequential strand-transfers of partial cDNA intermediates copied from viral genomic RNA. Right here, we revealed an unprecedented position of 5′-end guanosine (G) of HIV-1 genomic RNA for reverse transcription. Based mostly on present consensus for HIV-1 transcription initiation web site, HIV-1 transcripts possess a single G at 5′-ends (G1-form). Nonetheless, we discovered that HIV-1 transcripts with further Gs at 5′-ends (G2- and G3-forms) had been abundantly expressed in contaminated cells by utilizing various transcription initiation websites.

The G2- and G3-forms had been additionally detected within the virus particle, though the G1-form predominated. To handle organic affect of the 5′-G quantity, we generated HIV clone DNA to precise the G1-form solely by deleting the choice initiation websites. Virus produced from the clone confirmed considerably larger strand-transfer of minus strong-stop cDNA (-sscDNA). The in vitro assay utilizing artificial HIV-1 RNAs revealed that the abortive types of -sscDNA had been abundantly generated from the G3-form RNA, however dramatically diminished from the G1-form. Furthermore, the strand-transfer of -sscDNA from the G1-form was prominently stimulated by HIV-1 nucleocapsid. Taken collectively, our outcomes demonstrated that the 5′-G quantity that corresponds to HIV-1 transcription initiation web site was vital for profitable strand-transfer of -sscDNA throughout reverse transcription.

Extraction of Complete DNA and RNA from Marine Filter Samples and Era of a cDNA as Common Template for Marker Gene Research.

Microbial communities play an vital position in marine ecosystem processes. Though the variety of research concentrating on marker genes such because the 16S rRNA gene has been elevated in the previous few years, the overwhelming majority of marine range is relatively unexplored.

Purification of Single-Stranded cDNA Based on RNA Degradation Treatment and Adsorption Chromatography.

Furthermore, most research centered on the complete bacterial group and thus disregarded energetic microbial group gamers. Right here, we describe an in depth protocol for the simultaneous extraction of DNA and RNA from marine water samples and for the technology of cDNA from the remoted RNA which can be utilized as a common template in numerous marker gene research.

Probe-Directed Degradation (PDD) for Versatile Removing of Undesirable cDNA Sequences from RNA-Seq Libraries.

Most purposes for RNA-seq require the depletion of plentiful transcripts to realize higher protection of the underlying transcriptome. The sequences to be focused for depletion rely upon software and species and in lots of circumstances will not be supported by business depletion kits. This unit describes a way for producing RNA-seq libraries that includes probe-directed degradation (PDD), which might deplete any undesirable sequence set, with the low-bias split-adapter technique of library technology (though many different library technology strategies are in precept suitable).

The general technique is appropriate for purposes requiring personalized sequence depletion or the place trustworthy illustration of fragment ends and lack of sequence bias is paramount. We offer tips to quickly design particular probes towards the goal sequence, and an in depth protocol for library technology utilizing the split-adapter technique together with a number of methods for streamlining the approach and lowering adapter dimer content material.

Defects in RNase H2 Stimulate DNA Break Restore by RNA Reverse Transcribed into cDNA.

Eukaryotic ribonucleases (RNase) H1 and H2 are endonucleases that cleave RNA in a double- stranded RNA-DNA molecule. RNase H2 may cleave a single ribonucleotide embedded in DNA duplex. Whereas the exercise of RNase H1 and H2 has been extensively characterised in vitro, nonetheless a lot is unclear concerning the particular targets of those enzymes in vivo. We not too long ago demonstrated that yeast cells can restore a double-strand break (DSB) in DNA by homologous recombination (HR) utilizing antisense (non-coding) RNA, both straight, or not directly after changing RNA into cDNA.

In wildtype RNase H1 and/or H2 cells, restore by cDNA dominates, whereas within the absence of RNase H1 and H2 capabilities cDNA and, particularly, direct transcript-RNA restore mechanisms are markedly stimulated. Right here we discovered that null alleles of any of the three RNase H2 subunits stimulate DSB restore by cDNA considerably greater than a null allele of RNase H1.

These outcomes present that RNase H2 is the popular RNase H enzyme to focus on cDNA in yeast. Concentrating on of cDNA by RNase H2 doesn’t require RNase H2 interplay with the DNA clamp proliferating cell nuclear antigen (PCNA).

Human Neuroplastin (NPTN) ELISA Kit

RD-NPTN-Hu-48Tests 48 Tests
EUR 521

Human Neuroplastin (NPTN) ELISA Kit

RD-NPTN-Hu-96Tests 96 Tests
EUR 723

NPTN antibody

10R-7067 100 ul
EUR 726
Description: Mouse monoclonal NPTN antibody

NPTN antibody

10R-7068 100 ul
EUR 691
Description: Mouse monoclonal NPTN antibody

NPTN antibody

10R-7069 100 ul
EUR 691
Description: Mouse monoclonal NPTN antibody

NPTN Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NPTN. Recognizes NPTN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

NPTN Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NPTN. Recognizes NPTN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

NPTN Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NPTN. Recognizes NPTN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human Neuroplastin (NPTN) ELISA Kit

SEC666Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuroplastin (NPTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuroplastin (NPTN) in tissue homogenates, cell lysates and other biological fluids.

Human Neuroplastin (NPTN) ELISA Kit

SEC666Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuroplastin (NPTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuroplastin (NPTN) in tissue homogenates, cell lysates and other biological fluids.

Human Neuroplastin (NPTN) ELISA Kit

SEC666Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuroplastin (NPTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuroplastin (NPTN) in tissue homogenates, cell lysates and other biological fluids.

Human Neuroplastin (NPTN) ELISA Kit

SEC666Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuroplastin (NPTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuroplastin (NPTN) in tissue homogenates, cell lysates and other biological fluids.

Human Neuroplastin (NPTN) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neuroplastin elisa. Alternative names of the recognized antigen: SDR1
  • GP55
  • GP65
  • SDFR1
  • np55
  • np65
  • Stromal Cell Derived Factor Receptor 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Neuroplastin (NPTN) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

NPTN Polyclonal Antibody

31395-100ul 100ul
EUR 252

NPTN Polyclonal Antibody

31395-50ul 50ul
EUR 187

Neuroplastin (NPTN) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Neuroplastin (NPTN) Antibody

abx027055-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Neuroplastin (NPTN) Antibody

abx027055-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Neuroplastin (NPTN) Antibody

  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Neuroplastin (NPTN) Antibody

abx146042-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Neuroplastin (NPTN) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Neuroplastin (NPTN) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Neuroplastin (NPTN) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuroplastin (NPTN) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

NPTN cloning plasmid

CSB-CL016028HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 849
  • Sequence: atgtcgggttcgtcgctgcccagcgccctggccctctcgctgttgctggtctctggctccctcctcccagggccaggcgccgctcagaacgagccaaggattgtcaccagtgaagaggtcattattcgagacagccctgttctccctgtcaccctgcagtgtaacctcacctccag
  • Show more
Description: A cloning plasmid for the NPTN gene.

NPTN Rabbit pAb

A7972-100ul 100 ul
EUR 308

NPTN Rabbit pAb

A7972-200ul 200 ul
EUR 459

NPTN Rabbit pAb

A7972-20ul 20 ul
EUR 183

NPTN Rabbit pAb

A7972-50ul 50 ul
EUR 223

Anti-NPTN antibody

STJ110279 100 µl
EUR 277
Description: This gene encodes a type I transmembrane protein belonging to the Ig superfamily. The protein is believed to be involved in cell-cell interactions or cell-substrate interactions. Alternative splicing results in multiple transcript variants.


EF007364 96 Tests
EUR 689

Mouse NPTN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat NPTN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NPTN Polyclonal Conjugated Antibody

C31395 100ul
EUR 397

Human Neuroplastin (NPTN) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human NPTN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NPTN Recombinant Protein (Human)

RP041734 100 ug Ask for price

NPTN Recombinant Protein (Mouse)

RP154784 100 ug Ask for price

NPTN Recombinant Protein (Rat)

RP214388 100 ug Ask for price

Human Neuroplastin (NPTN) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Neuroplastin (NPTN) ELISA Kit

abx257574-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Human NPTN(Neuroplastin) ELISA Kit

EH4175 96T
EUR 524.1
  • Detection range: 31.25-2000 pg/ml
  • Uniprot ID: Q9Y639
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Neuroplastin, NPTN ELISA KIT

ELI-14849h 96 Tests
EUR 824

Rat Neuroplastin (NPTN) ELISA Kit

abx391703-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Neuroplastin (NPTN) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Neuroplastin (NPTN) ELISA Kit

abx390037-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Neuroplastin, Nptn ELISA KIT

ELI-35323r 96 Tests
EUR 886

Mouse Neuroplastin, Nptn ELISA KIT

ELI-39707m 96 Tests
EUR 865

Nptn ORF Vector (Rat) (pORF)

ORF071464 1.0 ug DNA
EUR 506

h NPTN inducible lentiviral particles

LVP406 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made inducible lentiviral particles for expressing human target: NPTN (alternative name: GP55; GP65; SDR1; np55; np65; SDFR1), with ORF sequence 100% matching to CDS region in NCBI ID: NM_017455.

NPTN ORF Vector (Human) (pORF)

ORF013912 1.0 ug DNA
EUR 354

Nptn ORF Vector (Mouse) (pORF)

ORF051596 1.0 ug DNA
EUR 506

Human Neuroplastin(NPTN)ELISA Kit

QY-E04762 96T
EUR 361

NPTN ELISA Kit (Human) (OKCD08220)

OKCD08220 96 Wells
EUR 975
Description: Description of target: Neuroplastin is a type I transmembrane protein belonging to the Ig superfamily. The protein is believed to be involved in cell-cell interactions or cell-substrate interactions. The alpha and beta transcripts show differential localization within the brain.Neuroplastin is a type I transmembrane protein belonging to the Ig superfamily. The protein is believed to be involved in cell-cell interactions or cell-substrate interactions. The alpha and beta transcripts show differential localization within the brain.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.058ng/mL

NPTN ELISA Kit (Human) (OKDD00432)

OKDD00432 96 Wells
EUR 975
Description: Description of target: This gene encodes a type I transmembrane protein belonging to the Ig superfamily. The protein is believed to be involved in cell-cell interactions or cell-substrate interactions. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.052 ng/mL

cDNA Synthesis SuperMix

  • EUR 565.00
  • EUR 481.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

Evo? cDNA Kit

EUR 294

Evo? cDNA Kit

EUR 234

Novo? cDNA Kit

EUR 354

Novo? cDNA Kit

EUR 267

Evo? cDNA Supermix

EUR 381

Evo? cDNA Supermix

EUR 267

Novo? cDNA Supermix

EUR 441

Novo? cDNA Supermix

EUR 289

cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis

C1634310 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Corn

C1634330 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Orange

C1634340 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Potato

C1634350 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Rice

C1634360 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Wheat

C1634390 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

ELISA kit for Human NPTN (Neuroplastin)

ELK4704 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neuroplastin (NPTN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neuroplastin (
  • Show more
Description: A sandwich ELISA kit for detection of Neuroplastin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Nptn sgRNA CRISPR Lentivector set (Mouse)

K4866601 3 x 1.0 ug
EUR 339

Nptn sgRNA CRISPR Lentivector set (Rat)

K6791401 3 x 1.0 ug
EUR 339

NPTN sgRNA CRISPR Lentivector set (Human)

K1449901 3 x 1.0 ug
EUR 339

First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)

  • EUR 620.00
  • EUR 523.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)

  • EUR 871.00
  • EUR 662.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean

C1634370 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA Probe Diluent Solution

AR0063 5mL
EUR 106

cDNA from Arteriosclerosis: Aorta

C1236012Hd-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Artery

C1236013Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Arteriosclerosis: Artery

C1236013Hd-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Vein

C1236020Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Colon

C1236090Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart

C1236122Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Heart

C1236122Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Kidney

C1236142Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Kidney

C1236142Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Liver

C1236149Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Asthma: Lung

C1236152Ld-1 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Bronchitis: Lung

C1236152Ld-2 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Emphysema: Lung

C1236152Ld-3 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Pneumonia: Lung

C1236152Ld-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Lung

C1236152Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Pancreas

C1236188Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Spleen

C1236246Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: stomach

C1236248Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Tetro cDNA Synthesis Kit

BIO-65042 30 Reactions Ask for price

Tetro cDNA Synthesis Kit

BIO-65043 100 Reactions Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65053 50 Reactions Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65053/S Sample Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65054 250 Reactions Ask for price

OneScriptPlus cDNA Synthesis Kit

G235 25 x 20 ul reactions
EUR 97

OneScriptPlus cDNA Synthesis Kit

G236 100 x 20 ul reactions
EUR 169

OneScriptPlus cDNA Synthesis SuperMix

G453 25 x 20 ul reactions
EUR 97

OneScriptPlus cDNA Synthesis SuperMix

G454 100 x 20 ul reactions
EUR 169

circRNA cDNA Synthesis Kit

G627 25 rxn (20 ul/rxn)
EUR 309

Human eNOS cDNA probe

eNOS51-D-2 2 ug
EUR 445

Novo? Transcriptome cDNA Kit

EUR 952

Novo? Transcriptome cDNA Kit

EUR 441

Plant Tissue cDNA: Arabidopsis

PC34-310 10 rxn
EUR 415

Nptn ELISA Kit| Rat Neuroplastin ELISA Kit

EF019063 96 Tests
EUR 689

Nptn ELISA Kit| Mouse Neuroplastin ELISA Kit

EF015676 96 Tests
EUR 689

Nptn sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4866602 1.0 ug DNA
EUR 154

Nptn sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4866603 1.0 ug DNA
EUR 154

Nptn sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4866604 1.0 ug DNA
EUR 154

Nptn sgRNA CRISPR Lentivector (Rat) (Target 1)

K6791402 1.0 ug DNA
EUR 154

Nptn sgRNA CRISPR Lentivector (Rat) (Target 2)

K6791403 1.0 ug DNA
EUR 154

Nptn sgRNA CRISPR Lentivector (Rat) (Target 3)

K6791404 1.0 ug DNA
EUR 154

NPTN sgRNA CRISPR Lentivector (Human) (Target 1)

K1449902 1.0 ug DNA
EUR 154

NPTN sgRNA CRISPR Lentivector (Human) (Target 2)

K1449903 1.0 ug DNA
EUR 154

NPTN sgRNA CRISPR Lentivector (Human) (Target 3)

K1449904 1.0 ug DNA
EUR 154

NPTN Protein Vector (Rat) (pPB-C-His)

PV285854 500 ng
EUR 603

NPTN Protein Vector (Rat) (pPB-N-His)

PV285855 500 ng
EUR 603

NPTN Protein Vector (Rat) (pPM-C-HA)

PV285856 500 ng
EUR 603

NPTN Protein Vector (Rat) (pPM-C-His)

PV285857 500 ng
EUR 603

NPTN Protein Vector (Mouse) (pPB-C-His)

PV206382 500 ng
EUR 603

NPTN Protein Vector (Mouse) (pPB-N-His)

PV206383 500 ng
EUR 603

NPTN Protein Vector (Mouse) (pPM-C-HA)

PV206384 500 ng
EUR 603

NPTN Protein Vector (Mouse) (pPM-C-His)

PV206385 500 ng
EUR 603

NPTN Protein Vector (Human) (pPB-C-His)

PV055645 500 ng
EUR 481

NPTN Protein Vector (Human) (pPB-N-His)

PV055646 500 ng
EUR 481

NPTN Protein Vector (Human) (pPM-C-HA)

PV055647 500 ng
EUR 481

NPTN Protein Vector (Human) (pPM-C-His)

PV055648 500 ng
EUR 481

Nptn 3'UTR Luciferase Stable Cell Line

TU114271 1.0 ml Ask for price

Nptn 3'UTR GFP Stable Cell Line

TU164271 1.0 ml Ask for price

Nptn 3'UTR Luciferase Stable Cell Line

TU214142 1.0 ml Ask for price

Nptn 3'UTR GFP Stable Cell Line

TU264142 1.0 ml Ask for price

NPTN 3'UTR GFP Stable Cell Line

TU065917 1.0 ml
EUR 1394

NPTN 3'UTR Luciferase Stable Cell Line

TU015917 1.0 ml
EUR 1394

cDNA Synthesis SuperMix for qPCR

  • EUR 690.00
  • EUR 565.00
  • 100 rxns ×20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

cDNA from Alzheimer's Disease: Brain

C1236035Alz 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Brain

C1236035Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Parkinson's Disease: Brain

C1236035Par 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Dementia: Brain: Hippocampus

C1236052Dem 40 reactions
EUR 801
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Depression: Brain: Hippocampus

C1236052Dep 40 reactions
EUR 801
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Colon

C1236090Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Esophagus

C1236106Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Heart

C1236122Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Interventricular Septum

C1236130Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Kidney

C1236142Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Liver

C1236149Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Lung

C1236152Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Pulmonary Embolism: Lung

C1236152Ld-5 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Diaphragm

C1236169Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Pancreas

C1236188Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Skin

C1236218Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Small Intestine

C1236226Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Spinal Cord

C1236234Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Spleen

C1236246Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Human Tumor Tissue: Breast cDNA

HT05-090 10 rxn
EUR 415

Human Adult cDNA Tissue: Lung

HA-152 10 rxn
EUR 415

Human Adult cDNA Tissue: Skin

HA-218 10 rxn
EUR 415

Human Adult cDNA Tissue: Testis

HA-260 10 rxn
EUR 415

Total-Transcriptome cDNA Synthesis Kit

G904 25 reactions
EUR 224

Total-Transcriptome cDNA Synthesis Kit

G905 100 reactions
EUR 544

Mouse iNOS (macrophage) cDNA probe

iNOS61-D-2 2 ug
EUR 445

Evo? cDNA Kit (gDNA Removal)

EUR 381

Monkey (Rhesus) cDNA Tissue: Thyroid

MR34-265 10 rxn
EUR 415

Accuris qMax cDNA Synthesis Kit

PR2100-C-100 1 PC
EUR 337.75
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Accuris qMax cDNA Synthesis Kit

PR2100-C-25 1 PC
EUR 142.36
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Accuris qMax cDNA Synthesis Kit

PR2100-C-250 1 PC
EUR 711.77
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Accuris qMax cDNA Synthesis Kit

PR2100-C-S 1 PC
EUR 77.76
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

amfiRivert cDNA Synthesis Master Mix

R5101-050 50 rxns
EUR 415

amfiRivert cDNA Synthesis Master Mix

R5101-100 2X50 rxns
EUR 847

amfiRivert cDNA Synthesis Master Mix

R5101-200 4X50 rxns
EUR 1211

amfiRivet cDNA Synthesis 2X Buffer

R5102-050 500ul
EUR 134

amfiRivet cDNA Synthesis 2X Buffer

R5102-100 2x500ul
EUR 192

NPTN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV660577 1.0 ug DNA
EUR 682

NPTN Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV660581 1.0 ug DNA
EUR 682

NPTN Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV660582 1.0 ug DNA
EUR 682

pCDH-CMV-MCS-EF1-Puro cDNA Vector cDNA Clon/Exp Vector [pre-packaged virus]

CD510VB-1 >1 x 10^6 IFUs
EUR 786
  • Category: Lentiviral Technology

All-in-One cDNA Synthesis SuperMix

B24403 200 ractions
EUR 456
Description: All-in-One cDNA Synthesis SuperMix contains all the necessary components pre-blended in one tube for reverse transcription.

All-in-One cDNA Synthesis SuperMix

B24408 1000 ractions
EUR 1453
Description: All-in-One cDNA Synthesis SuperMix contains all the necessary components pre-blended in one tube for reverse transcription.

AzuraQuant cDNA Synthesis Kit - 25 Reactions

AZ-1995 25 Reactions
EUR 153

AzuraQuant cDNA Synthesis Kit - 100 Reactions

AZ-1996 100 Reactions
EUR 372

miRNA First-Strand cDNA Synthesis SuperMix

abx098020-20rxns20ulSystems 20 rxns × 20 ul Systems
EUR 732
  • Shipped within 5-10 working days.

Fly First-Strand cDNA Synthesis SuperMix

  • EUR 718.00
  • EUR 578.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

cDNA from Human Tumor Tissue: Adrenal

C1235004-10 10 reactions
EUR 282
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Bladder

C1235010-10 10 reactions
EUR 282
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Bone

C1235023-10 10 reactions
EUR 282
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Brain

C1235035-10 10 reactions
EUR 282
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Breast

C1235086 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Colon

C1235090 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Furthermore, yeast RNase H2 orthologous mutants of two widespread RNase H2 defects related to Aicardi Goutières syndrome (AGS) in people, displayed elevated cDNA-driven restore of a DSB when mixed with one another or with RNase H1 null mutation. Our findings assist the speculation that faulty RNase H2 alleles have larger stage of cDNA derived from both coding or non-coding RNA within the type of RNA-cDNA hybrids.


Leave a Reply

Your email address will not be published. Required fields are marked *