Purification of Single-Stranded cDNA Based on RNA Degradation Treatment and Adsorption Chromatography.

Evaluation of gene expression is a standard analysis instrument to check networks controlling gene expression, the position of genes with unknown perform, and environmentally induced responses of organisms. A lot of the analytical instruments used to investigate gene expression depend on correct cDNA synthesis and quantification to acquire reproducible and quantifiable outcomes. So far, most business kits for isolation and purification of cDNA goal double-stranded molecules, which don’t precisely characterize the abundance of transcripts.

Within the current report, we offer a easy and quick technique to purify single-stranded cDNA, exhibiting excessive purity and yield. This technique is predicated on the therapy with RNase H and RNase A after cDNA synthesis, adopted by separation in silica spin-columns and ethanol precipitation. As well as, our technique avoids the usage of DNase I to get rid of genomic DNA from RNA preparations, which improves cDNA yield. As a case report, our technique proved to be helpful within the purification of single-stranded cDNA from the pathogenic fungus Sporothrix schenckii.

Destiny of HIV-1 cDNA intermediates throughout reverse transcription is dictated by transcription initiation web site of virus genomic RNA.

Retroviral reverse transcription is completed by sequential strand-transfers of partial cDNA intermediates copied from viral genomic RNA. Right here, we revealed an unprecedented position of 5′-end guanosine (G) of HIV-1 genomic RNA for reverse transcription. Based mostly on present consensus for HIV-1 transcription initiation web site, HIV-1 transcripts possess a single G at 5′-ends (G1-form). Nonetheless, we discovered that HIV-1 transcripts with further Gs at 5′-ends (G2- and G3-forms) had been abundantly expressed in contaminated cells by utilizing various transcription initiation websites.

The G2- and G3-forms had been additionally detected within the virus particle, though the G1-form predominated. To handle organic affect of the 5′-G quantity, we generated HIV clone DNA to precise the G1-form solely by deleting the choice initiation websites. Virus produced from the clone confirmed considerably larger strand-transfer of minus strong-stop cDNA (-sscDNA). The in vitro assay utilizing artificial HIV-1 RNAs revealed that the abortive types of -sscDNA had been abundantly generated from the G3-form RNA, however dramatically diminished from the G1-form. Furthermore, the strand-transfer of -sscDNA from the G1-form was prominently stimulated by HIV-1 nucleocapsid. Taken collectively, our outcomes demonstrated that the 5′-G quantity that corresponds to HIV-1 transcription initiation web site was vital for profitable strand-transfer of -sscDNA throughout reverse transcription.

Extraction of Complete DNA and RNA from Marine Filter Samples and Era of a cDNA as Common Template for Marker Gene Research.

Microbial communities play an vital position in marine ecosystem processes. Though the variety of research concentrating on marker genes such because the 16S rRNA gene has been elevated in the previous few years, the overwhelming majority of marine range is relatively unexplored.

Furthermore, most research centered on the complete bacterial group and thus disregarded energetic microbial group gamers. Right here, we describe an in depth protocol for the simultaneous extraction of DNA and RNA from marine water samples and for the technology of cDNA from the remoted RNA which can be utilized as a common template in numerous marker gene research.

Probe-Directed Degradation (PDD) for Versatile Removing of Undesirable cDNA Sequences from RNA-Seq Libraries.

Most purposes for RNA-seq require the depletion of plentiful transcripts to realize higher protection of the underlying transcriptome. The sequences to be focused for depletion rely upon software and species and in lots of circumstances will not be supported by business depletion kits. This unit describes a way for producing RNA-seq libraries that includes probe-directed degradation (PDD), which might deplete any undesirable sequence set, with the low-bias split-adapter technique of library technology (though many different library technology strategies are in precept suitable).

The general technique is appropriate for purposes requiring personalized sequence depletion or the place trustworthy illustration of fragment ends and lack of sequence bias is paramount. We offer tips to quickly design particular probes towards the goal sequence, and an in depth protocol for library technology utilizing the split-adapter technique together with a number of methods for streamlining the approach and lowering adapter dimer content material.

Defects in RNase H2 Stimulate DNA Break Restore by RNA Reverse Transcribed into cDNA.

Eukaryotic ribonucleases (RNase) H1 and H2 are endonucleases that cleave RNA in a double- stranded RNA-DNA molecule. RNase H2 may cleave a single ribonucleotide embedded in DNA duplex. Whereas the exercise of RNase H1 and H2 has been extensively characterised in vitro, nonetheless a lot is unclear concerning the particular targets of those enzymes in vivo. We not too long ago demonstrated that yeast cells can restore a double-strand break (DSB) in DNA by homologous recombination (HR) utilizing antisense (non-coding) RNA, both straight, or not directly after changing RNA into cDNA.

In wildtype RNase H1 and/or H2 cells, restore by cDNA dominates, whereas within the absence of RNase H1 and H2 capabilities cDNA and, particularly, direct transcript-RNA restore mechanisms are markedly stimulated. Right here we discovered that null alleles of any of the three RNase H2 subunits stimulate DSB restore by cDNA considerably greater than a null allele of RNase H1.

These outcomes present that RNase H2 is the popular RNase H enzyme to focus on cDNA in yeast. Concentrating on of cDNA by RNase H2 doesn’t require RNase H2 interplay with the DNA clamp proliferating cell nuclear antigen (PCNA).

Human Neuroplastin (NPTN) ELISA Kit
RDR-NPTN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Neuroplastin (NPTN) ELISA Kit
RDR-NPTN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

NPTN siRNA
20-abx903630	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NPTN siRNA
20-abx926287	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NPTN siRNA
20-abx926288	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NPTN antibody
10R-7067	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal NPTN antibody

NPTN antibody
10R-7068	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal NPTN antibody

NPTN antibody
10R-7069	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal NPTN antibody

NPTN Antibody
1-CSB-PA008837	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NPTN. Recognizes NPTN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

NPTN Antibody
1-CSB-PA016028ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NPTN. Recognizes NPTN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

NPTN Antibody
1-CSB-PA016028ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NPTN. Recognizes NPTN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Human Neuroplastin (NPTN) ELISA Kit
SEC666Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuroplastin (NPTN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuroplastin (NPTN) in tissue homogenates, cell lysates and other biological fluids.

Human Neuroplastin (NPTN) ELISA Kit
SEC666Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuroplastin (NPTN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuroplastin (NPTN) in tissue homogenates, cell lysates and other biological fluids.

Human Neuroplastin (NPTN) ELISA Kit
SEC666Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuroplastin (NPTN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuroplastin (NPTN) in tissue homogenates, cell lysates and other biological fluids.

Human Neuroplastin (NPTN) ELISA Kit
SEC666Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuroplastin (NPTN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuroplastin (NPTN) in tissue homogenates, cell lysates and other biological fluids.

Human Neuroplastin (NPTN) ELISA Kit
4-SEC666Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Neuroplastin elisa. Alternative names of the recognized antigen: SDR1 GP55 GP65 SDFR1 np55 np65 Stromal Cell Derived Factor Receptor 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Neuroplastin (NPTN) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

NPTN cloning plasmid
CSB-CL016028HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 849 Sequence: atgtcgggttcgtcgctgcccagcgccctggccctctcgctgttgctggtctctggctccctcctcccagggccaggcgccgctcagaacgagccaaggattgtcaccagtgaagaggtcattattcgagacagccctgttctccctgtcaccctgcagtgtaacctcacctccag Show more
Description: A cloning plasmid for the NPTN gene.

Neuroplastin (NPTN) Antibody
abx146042-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Neuroplastin (NPTN) Antibody
20-abx006050	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Neuroplastin (NPTN) Antibody
abx027055-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Neuroplastin (NPTN) Antibody
abx027055-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Neuroplastin (NPTN) Antibody
20-abx173801	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Neuroplastin (NPTN) Antibody
20-abx177788	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Neuroplastin (NPTN) Antibody
20-abx321072	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Neuroplastin (NPTN) Antibody
20-abx321948	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Neuroplastin (NPTN) Antibody
20-abx326686	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

NPTN Rabbit pAb
A7972-100ul	Abclonal	100 ul	EUR 308

NPTN Rabbit pAb
A7972-200ul	Abclonal	200 ul	EUR 459

NPTN Rabbit pAb
A7972-20ul	Abclonal	20 ul	EUR 183

NPTN Rabbit pAb
A7972-50ul	Abclonal	50 ul	EUR 223

NPTN Polyclonal Antibody
31395-100ul	SAB	100ul	EUR 252

NPTN Polyclonal Antibody
31395-50ul	SAB	50ul	EUR 187

Anti-NPTN antibody
STJ110279	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a type I transmembrane protein belonging to the Ig superfamily. The protein is believed to be involved in cell-cell interactions or cell-substrate interactions. Alternative splicing results in multiple transcript variants.

Human Neuroplastin (NPTN) Protein
20-abx654543	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

NPTN Polyclonal Conjugated Antibody
C31395	SAB	100ul	EUR 397

Rat NPTN shRNA Plasmid
20-abx985858	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NPTN ELISA KIT|Human
EF007364	Lifescience Market	96 Tests	EUR 689

Human NPTN shRNA Plasmid
20-abx958925	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse NPTN shRNA Plasmid
20-abx972619	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NPTN Recombinant Protein (Human)
RP041734	ABM	100 ug	Ask for price

NPTN Recombinant Protein (Rat)
RP214388	ABM	100 ug	Ask for price

NPTN Recombinant Protein (Mouse)
RP154784	ABM	100 ug	Ask for price

Human NPTN(Neuroplastin) ELISA Kit
EH4175	FN Test	96T	EUR 524.1
Detection range: 31.25-2000 pg/ml Uniprot ID: Q9Y639
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Neuroplastin, NPTN ELISA KIT
ELI-14849h	Lifescience Market	96 Tests	EUR 824

Rat Neuroplastin, Nptn ELISA KIT
ELI-35323r	Lifescience Market	96 Tests	EUR 886

Mouse Neuroplastin, Nptn ELISA KIT
ELI-39707m	Lifescience Market	96 Tests	EUR 865

Human Neuroplastin (NPTN) ELISA Kit
20-abx152508	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Neuroplastin (NPTN) CLIA Kit
20-abx493824	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Neuroplastin (NPTN) ELISA Kit
abx257574-96tests	Abbexa	96 tests	EUR 637
Shipped within 5-12 working days.

Mouse Neuroplastin (NPTN) ELISA Kit
abx390037-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Neuroplastin (NPTN) ELISA Kit
abx391703-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

h NPTN inducible lentiviral particles
LVP406	GenTarget	1x107 IFU/ml x 200ul	EUR 451
Description: Pre-made inducible lentiviral particles for expressing human target: NPTN (alternative name: GP55; GP65; SDR1; np55; np65; SDFR1), with ORF sequence 100% matching to CDS region in NCBI ID: NM_017455.

Nptn ORF Vector (Rat) (pORF)
ORF071464	ABM	1.0 ug DNA	EUR 506

NPTN ORF Vector (Human) (pORF)
ORF013912	ABM	1.0 ug DNA	EUR 354

Nptn ORF Vector (Mouse) (pORF)
ORF051596	ABM	1.0 ug DNA	EUR 506

Human Neuroplastin(NPTN)ELISA Kit
QY-E04762	Qayee Biotechnology	96T	EUR 361

NPTN ELISA Kit (Human) (OKCD08220)
OKCD08220	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: Neuroplastin is a type I transmembrane protein belonging to the Ig superfamily. The protein is believed to be involved in cell-cell interactions or cell-substrate interactions. The alpha and beta transcripts show differential localization within the brain.Neuroplastin is a type I transmembrane protein belonging to the Ig superfamily. The protein is believed to be involved in cell-cell interactions or cell-substrate interactions. The alpha and beta transcripts show differential localization within the brain.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.058ng/mL

NPTN ELISA Kit (Human) (OKDD00432)
OKDD00432	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene encodes a type I transmembrane protein belonging to the Ig superfamily. The protein is believed to be involved in cell-cell interactions or cell-substrate interactions. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.052 ng/mL

cDNA Synthesis SuperMix
20-abx09801420ulSystems	Abbexa	EUR 565.00 EUR 481.00	100 rxns × 20 ul Systems 50 rxns × 20 ul Systems
Shipped within 5-10 working days.

Evo? cDNA Kit
M1164-100	Biovision		EUR 294

Evo? cDNA Kit
M1164-25	Biovision		EUR 234

Novo? cDNA Kit
M1165-100	Biovision		EUR 354

Novo? cDNA Kit
M1165-25	Biovision		EUR 267

Evo? cDNA Supermix
M1168-100	Biovision		EUR 381

Evo? cDNA Supermix
M1168-25	Biovision		EUR 267

Novo? cDNA Supermix
M1169-100	Biovision		EUR 441

Novo? cDNA Supermix
M1169-25	Biovision		EUR 289

cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis
C1634310	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Corn
C1634330	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Orange
C1634340	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Potato
C1634350	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Rice
C1634360	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Wheat
C1634390	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

ELISA kit for Human NPTN (Neuroplastin)
ELK4704	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neuroplastin (NPTN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neuroplastin ( Show more
Description: A sandwich ELISA kit for detection of Neuroplastin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

NPTN sgRNA CRISPR Lentivector set (Human)
K1449901	ABM	3 x 1.0 ug	EUR 339

Nptn sgRNA CRISPR Lentivector set (Mouse)
K4866601	ABM	3 x 1.0 ug	EUR 339

Nptn sgRNA CRISPR Lentivector set (Rat)
K6791401	ABM	3 x 1.0 ug	EUR 339

cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean
C1634370	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)
20-abx09801620ulSystems	Abbexa	EUR 620.00 EUR 523.00	100 rxns × 20 ul Systems 50 rxns × 20 ul Systems
Shipped within 5-10 working days.

First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)
20-abx09802120ulSystems	Abbexa	EUR 871.00 EUR 662.00	100 rxns × 20 ul Systems 50 rxns × 20 ul Systems
Shipped within 5-10 working days.

cDNA Probe Diluent Solution
AR0063	BosterBio	5mL	EUR 106

Tetro cDNA Synthesis Kit
BIO-65042	Bioline	30 Reactions	Ask for price

Tetro cDNA Synthesis Kit
BIO-65043	Bioline	100 Reactions	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65053	Bioline	50 Reactions	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65053/S	Bioline	Sample	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65054	Bioline	250 Reactions	Ask for price

cDNA from Arteriosclerosis: Aorta
C1236012Hd-4	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Artery
C1236013Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Arteriosclerosis: Artery
C1236013Hd-4	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Vein
C1236020Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Colon
C1236090Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart
C1236122Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Heart
C1236122Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Kidney
C1236142Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Kidney
C1236142Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Liver
C1236149Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Asthma: Lung
C1236152Ld-1	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Bronchitis: Lung
C1236152Ld-2	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Emphysema: Lung
C1236152Ld-3	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Pneumonia: Lung
C1236152Ld-4	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Lung
C1236152Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Pancreas
C1236188Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Spleen
C1236246Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: stomach
C1236248Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

OneScriptPlus cDNA Synthesis Kit
G235	ABM	25 x 20 ul reactions	EUR 97

OneScriptPlus cDNA Synthesis Kit
G236	ABM	100 x 20 ul reactions	EUR 169

OneScriptPlus cDNA Synthesis SuperMix
G453	ABM	25 x 20 ul reactions	EUR 97

OneScriptPlus cDNA Synthesis SuperMix
G454	ABM	100 x 20 ul reactions	EUR 169

circRNA cDNA Synthesis Kit
G627	ABM	25 rxn (20 ul/rxn)	EUR 309

Human eNOS cDNA probe
eNOS51-D-2	Alpha Diagnostics	2 ug	EUR 445

Plant Tissue cDNA: Arabidopsis
PC34-310	Alpha Diagnostics	10 rxn	EUR 415

Novo? Transcriptome cDNA Kit
M1167-100	Biovision		EUR 952

Novo? Transcriptome cDNA Kit
M1167-25	Biovision		EUR 441

Nptn ELISA Kit| Rat Neuroplastin ELISA Kit
EF019063	Lifescience Market	96 Tests	EUR 689

Nptn ELISA Kit| Mouse Neuroplastin ELISA Kit
EF015676	Lifescience Market	96 Tests	EUR 689

NPTN sgRNA CRISPR Lentivector (Human) (Target 1)
K1449902	ABM	1.0 ug DNA	EUR 154

NPTN sgRNA CRISPR Lentivector (Human) (Target 2)
K1449903	ABM	1.0 ug DNA	EUR 154

NPTN sgRNA CRISPR Lentivector (Human) (Target 3)
K1449904	ABM	1.0 ug DNA	EUR 154

Nptn sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4866602	ABM	1.0 ug DNA	EUR 154

Nptn sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4866603	ABM	1.0 ug DNA	EUR 154

Nptn sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4866604	ABM	1.0 ug DNA	EUR 154

Nptn sgRNA CRISPR Lentivector (Rat) (Target 1)
K6791402	ABM	1.0 ug DNA	EUR 154

Nptn sgRNA CRISPR Lentivector (Rat) (Target 2)
K6791403	ABM	1.0 ug DNA	EUR 154

Nptn sgRNA CRISPR Lentivector (Rat) (Target 3)
K6791404	ABM	1.0 ug DNA	EUR 154

NPTN Protein Vector (Human) (pPB-C-His)
PV055645	ABM	500 ng	EUR 481

NPTN Protein Vector (Human) (pPB-N-His)
PV055646	ABM	500 ng	EUR 481

NPTN Protein Vector (Human) (pPM-C-HA)
PV055647	ABM	500 ng	EUR 481

NPTN Protein Vector (Human) (pPM-C-His)
PV055648	ABM	500 ng	EUR 481

NPTN Protein Vector (Mouse) (pPB-C-His)
PV206382	ABM	500 ng	EUR 603

NPTN Protein Vector (Mouse) (pPB-N-His)
PV206383	ABM	500 ng	EUR 603

NPTN Protein Vector (Mouse) (pPM-C-HA)
PV206384	ABM	500 ng	EUR 603

NPTN Protein Vector (Mouse) (pPM-C-His)
PV206385	ABM	500 ng	EUR 603

NPTN Protein Vector (Rat) (pPB-C-His)
PV285854	ABM	500 ng	EUR 603

NPTN Protein Vector (Rat) (pPB-N-His)
PV285855	ABM	500 ng	EUR 603

NPTN Protein Vector (Rat) (pPM-C-HA)
PV285856	ABM	500 ng	EUR 603

NPTN Protein Vector (Rat) (pPM-C-His)
PV285857	ABM	500 ng	EUR 603

Nptn 3'UTR GFP Stable Cell Line
TU164271	ABM	1.0 ml	Ask for price

NPTN 3'UTR Luciferase Stable Cell Line
TU015917	ABM	1.0 ml	EUR 1394

Nptn 3'UTR Luciferase Stable Cell Line
TU114271	ABM	1.0 ml	Ask for price

NPTN 3'UTR GFP Stable Cell Line
TU065917	ABM	1.0 ml	EUR 1394

Nptn 3'UTR GFP Stable Cell Line
TU264142	ABM	1.0 ml	Ask for price

Nptn 3'UTR Luciferase Stable Cell Line
TU214142	ABM	1.0 ml	Ask for price

cDNA from Alzheimer's Disease: Brain
C1236035Alz	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Brain
C1236035Lcs	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Parkinson's Disease: Brain
C1236035Par	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Dementia: Brain: Hippocampus
C1236052Dem	Biochain	40 reactions	EUR 801
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Depression: Brain: Hippocampus
C1236052Dep	Biochain	40 reactions	EUR 801
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Colon
C1236090Lcs	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Esophagus
C1236106Lcs	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Heart
C1236122Lcs	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Interventricular Septum
C1236130Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Kidney
C1236142Lcs	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Liver
C1236149Lcs	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Lung
C1236152Lcs	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Pulmonary Embolism: Lung
C1236152Ld-5	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Diaphragm
C1236169Lcs	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Pancreas
C1236188Lcs	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Skin
C1236218Lcs	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Small Intestine
C1236226Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Spinal Cord
C1236234Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Spleen
C1236246Lcs	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Human Tumor Tissue: Breast cDNA
HT05-090	Alpha Diagnostics	10 rxn	EUR 415

Human Adult cDNA Tissue: Lung
HA-152	Alpha Diagnostics	10 rxn	EUR 415

Human Adult cDNA Tissue: Skin
HA-218	Alpha Diagnostics	10 rxn	EUR 415

Human Adult cDNA Tissue: Testis
HA-260	Alpha Diagnostics	10 rxn	EUR 415

Total-Transcriptome cDNA Synthesis Kit
G904	ABM	25 reactions	EUR 224

Total-Transcriptome cDNA Synthesis Kit
G905	ABM	100 reactions	EUR 544

Mouse iNOS (macrophage) cDNA probe
iNOS61-D-2	Alpha Diagnostics	2 ug	EUR 445

cDNA Synthesis SuperMix for qPCR
20-abx09801920ulSystems	Abbexa	EUR 690.00 EUR 565.00	100 rxns ×20 ul Systems 50 rxns × 20 ul Systems
Shipped within 5-10 working days.

Monkey (Rhesus) cDNA Tissue: Thyroid
MR34-265	Alpha Diagnostics	10 rxn	EUR 415

Accuris qMax cDNA Synthesis Kit
PR2100-C-100	BenchMark	1 PC	EUR 337.75
To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Accuris qMax cDNA Synthesis Kit
PR2100-C-25	BenchMark	1 PC	EUR 142.36
To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Accuris qMax cDNA Synthesis Kit
PR2100-C-250	BenchMark	1 PC	EUR 711.77
To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Accuris qMax cDNA Synthesis Kit
PR2100-C-S	BenchMark	1 PC	EUR 77.76
To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Evo? cDNA Kit (gDNA Removal)
M1166-100	Biovision		EUR 381

amfiRivert cDNA Synthesis Master Mix
R5101-050	GenDepot	50 rxns	EUR 415

amfiRivert cDNA Synthesis Master Mix
R5101-100	GenDepot	2X50 rxns	EUR 847

amfiRivert cDNA Synthesis Master Mix
R5101-200	GenDepot	4X50 rxns	EUR 1211

amfiRivet cDNA Synthesis 2X Buffer
R5102-050	GenDepot	500ul	EUR 134

amfiRivet cDNA Synthesis 2X Buffer
R5102-100	GenDepot	2x500ul	EUR 192

NPTN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV660577	ABM	1.0 ug DNA	EUR 682

NPTN Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV660581	ABM	1.0 ug DNA	EUR 682

NPTN Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV660582	ABM	1.0 ug DNA	EUR 682

pCDH-CMV-MCS-EF1-Puro cDNA Vector cDNA Clon/Exp Vector [pre-packaged virus]
CD510VB-1	SBI	>1 x 10^6 IFUs	EUR 786
Category: Lentiviral Technology

All-in-One cDNA Synthesis SuperMix
B24403	Bimake	200 ractions	EUR 456
Description: All-in-One cDNA Synthesis SuperMix contains all the necessary components pre-blended in one tube for reverse transcription.

All-in-One cDNA Synthesis SuperMix
B24408	Bimake	1000 ractions	EUR 1453
Description: All-in-One cDNA Synthesis SuperMix contains all the necessary components pre-blended in one tube for reverse transcription.

AzuraQuant cDNA Synthesis Kit - 25 Reactions
AZ-1995	Real Time Primers	25 Reactions	EUR 153

AzuraQuant cDNA Synthesis Kit - 100 Reactions
AZ-1996	Real Time Primers	100 Reactions	EUR 372

cDNA from Human Tumor Tissue: Adrenal
C1235004-10	Biochain	10 reactions	EUR 282
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Bladder
C1235010-10	Biochain	10 reactions	EUR 282
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Bone
C1235023-10	Biochain	10 reactions	EUR 282
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Brain
C1235035-10	Biochain	10 reactions	EUR 282
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Breast
C1235086	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Colon
C1235090	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Kidney
C1235142	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Liver
C1235149	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Furthermore, yeast RNase H2 orthologous mutants of two widespread RNase H2 defects related to Aicardi Goutières syndrome (AGS) in people, displayed elevated cDNA-driven restore of a DSB when mixed with one another or with RNase H1 null mutation. Our findings assist the speculation that faulty RNase H2 alleles have larger stage of cDNA derived from both coding or non-coding RNA within the type of RNA-cDNA hybrids.