Crosslinking and immunoprecipitation (CLIP) strategies are highly effective strategies to interrogate direct protein-RNA interactions and dissect posttranscriptional gene regulatory networks. One broadly used CLIP variant is photoactivatable ribonucleoside enhanced CLIP (PAR-CLIP) that entails in vivo labeling of nascent RNAs with the photoreactive nucleosides 4-thiouridine (4SU) or 6-thioguanosine (6SG), which might effectively crosslink to interacting proteins utilizing UVA and UVB mild.
Crosslinking of 4SU or 6SG to interacting amino acids adjustments their base-pairing properties and leads to attribute mutations in cDNA libraries ready for high-throughput sequencing, which could be computationally exploited to take away ample background from non-crosslinked sequences and assist pinpoint RNA binding protein binding websites at nucleotide decision on a transcriptome-wide scale.
Right here we current a streamlined protocol for fluorescence-based PAR-CLIP (fPAR-CLIP) that eliminates the necessity to use radioactivity. It’s primarily based on direct ligation of a fluorescently labeled adapter to the three’finish of crosslinked RNA on immobilized ribonucleoproteins, adopted by isolation of the adapter-ligated RNA and environment friendly conversion into cDNA with out the beforehand wanted measurement fractionation on denaturing polyacrylamide gels. These enhancements reduce the experimentation by half to 2 days and will increase sensitivity by 10-100-fold.
Characterization and evaluation of the transcriptome response to drought in Larix kaempferi utilizing PacBio full-length cDNA sequencing built-in with de novo RNA-seq reads
A hypothetical mannequin of drought tolerance mechanism of Larix kaempferi was established via SMRT-seq and Illumina HiSeq. Larix kaempferi is a vital financial and ecological species and a significant afforestation species in north-eastern China. Up to now, no info has been reliably derived concerning full-length cDNA sequencing info on L. kaempferi. By single-molecule long-read isoform sequencing (SMRT-seq), right here we report a complete of 26,153,342 subreads (21.24 Gb) and 330,371 round consensus sequence (CCS) reads after the modification of web site mismatch, and 35,414 unigenes have been efficiently collected.
To achieve deeper insights into the molecular mechanisms of L. kaempferi response to drought stress, we mixed Illumina HiSeq with SMRT-seq to decode full-length transcripts. On this examine, we report 27 differentially expressed genes (DEGs) concerned within the notion and transmission of drought stress indicators in L. kaempferi.
Numerous DEGs responding to drought stress have been detected in L. kaempferi, particularly DEGs concerned within the reactive oxygen species (ROS) scavenging, lignin biosynthesis, and sugar metabolism, and DEGs encoding drought stress proteins. We detected 73 transcription components (TFs) below drought stress, together with AP2/ERF, bZIP, TCP, and MYB. This examine offers primary full sequence sources for L. kaempferi analysis and can assist us to raised perceive the capabilities of drought-resistance genes in L. kaempferi.

cDNA-derived RNA phage meeting reveals important residues within the maturation protein of the Pseudomonas aeruginosa leviphage, PP7
PP7 is a leviphage with single-stranded RNA genome, which infects Pseudomonas aeruginosa PAO1. A reverse genetic system for PP7 was beforehand created through the use of reverse-transcribed cDNA (PP7O) from virion-derived RNA genome. Right here, we’ve discovered that the PP7O cDNA contained 20 nucleotide variations from the PP7 genome sequence deposited within the database.
We created one other reverse genetic system exploiting chemically synthesized cDNA (PP7S) primarily based on the database sequence. In contrast to PP7O that rendered infectious PP7 virions, PP7S-derived particles have been incapable of plaque formation on PAO1 cells, which was restored on the PAO1 cells expressing the maturation protein (MP) from PP7O Utilizing this reverse genetic system, we revealed two amino acid residues concerned within the identified roles of MP (i.e. adsorption and genome replication), fortuitously offering a lesson that the viral RNA genome sequencing wants purposeful verification presumably by a reverse genetic system.
IMPORTANCE Organic significance of RNA phages has been largely ignored, mockingly as a result of few research have been specializing in RNA phages. As an preliminary try to correctly signify RNA phages within the phageome, we beforehand created, through the use of reverse-transcribed cDNA, a reverse genetic system for the small RNA phage, PP7 that infects the opportunistic human pathogen, Pseudomonas aeruginosa We right here report one other system through the use of chemically synthesized cDNA primarily based on the database genome that has 20 nucleotide variations from the earlier cDNA.
Investigation of these cDNA-derived phage virions unveiled that two amino acids of the maturation protein are essential for the traditional phage lifecycle at totally different steps. Our examine offers an perception into the molecular foundation for the RNA phage lifecycle and a lesson that the RNA genome sequencing must be rigorously validated by cDNA-based phage meeting methods.
RNA–cDNA hybrids mediate transposition by way of totally different mechanisms
Retrotransposons can signify half of eukaryotic genomes. Retrotransposon dysregulation destabilizes genomes and has been linked to varied human ailments. Rising regulators of retromobility embrace RNA-DNA hybrid-containing constructions generally known as R-loops. Accumulation of those constructions on the transposons of yeast 1 (Ty1) parts has been proven to extend Ty1 retromobility via an unknown mechanism. Right here, by way of a focused genetic display screen, we recognized the rnh1Δ rad27Δ yeast mutant, which lacked each the Ty1 inhibitor Rad27 and the RNA-DNA hybrid suppressor Rnh1.
The mutant exhibited elevated ranges of Ty1 cDNA-associated RNA-DNA hybrids that promoted Ty1 mobility. Furthermore, on this rnh1Δ rad27Δ mutant, however not within the double RNase H mutant rnh1Δ rnh201Δ, RNA-DNA hybrids preferentially existed as duplex nucleic acid constructions and elevated Ty1 mobility in a Rad52-dependent method.
POLR3F Antibody |
1-CSB-PA884440LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against POLR3F. Recognizes POLR3F from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000 |
POLR3F Antibody |
1-CSB-PA018348GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against POLR3F. Recognizes POLR3F from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
POLR3F antibody |
70R-50816 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal POLR3F antibody |
POLR3F siRNA |
20-abx929231 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
POLR3F siRNA |
20-abx929232 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-POLR3F |
YF-PA17105 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to POLR3F |
anti-POLR3F |
YF-PA17106 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to POLR3F |
POLR3F Polyclonal Antibody |
27655-100ul |
SAB |
100ul |
EUR 252 |
POLR3F Polyclonal Antibody |
27655-50ul |
SAB |
50ul |
EUR 187 |
POLR3F Rabbit pAb |
A12224-100ul |
Abclonal |
100 ul |
EUR 308 |
POLR3F Rabbit pAb |
A12224-200ul |
Abclonal |
200 ul |
EUR 459 |
POLR3F Rabbit pAb |
A12224-20ul |
Abclonal |
20 ul |
EUR 183 |
POLR3F Rabbit pAb |
A12224-50ul |
Abclonal |
50 ul |
EUR 223 |
POLR3F Blocking Peptide |
33R-5238 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of POLR3F antibody, catalog no. 70R-2038 |
POLR3F Blocking Peptide |
33R-5647 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of POLR3F antibody, catalog no. 70R-2962 |
POLR3F Blocking Peptide |
20-abx063691 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
POLR3F cloning plasmid |
CSB-CL884440HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 951
- Sequence: atggcggaggtgaaggtgaaggtgcagccgcctgacgcggatccggtcgaaatagaaaacaggattatagaattatgtcaccagttccctcatggaatcacagaccaagtaattcagaatgaaatgcctcatatagaagcccagcagcgggcagtagccatcaataggttgttgtc
- Show more
|
Description: A cloning plasmid for the POLR3F gene. |
POLR3F Polyclonal Antibody |
A60346 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
anti- POLR3F antibody |
FNab06632 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: polymerase(RNA) III(DNA directed) polypeptide F, 39 kDa
- Uniprot ID: Q9H1D9
- Gene ID: 10621
- Research Area: Immunology, Metabolism
|
Description: Antibody raised against POLR3F |
Anti-POLR3F antibody |
STJ114115 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is one of more than a dozen subunits forming eukaryotic RNA polymerase III (RNA Pol III), which transcribes 5S ribosomal RNA and tRNA genes. This protein has been shown to bind both TFIIIB90 and TBP, two subunits of RNA polymerase III transcription initiation factor IIIB (TFIIIB). Unlike most of the other RNA Pol III subunits, the encoded protein is unique to this polymerase. Alternative splicing results in multiple transcript variants. |
POLR3F protein (His tag) |
30R-2961 |
Fitzgerald |
100 ug |
EUR 322 |
Description: Purified recombinant Human POLR3F protein (His tag) |
POLR3F Antibody, HRP conjugated |
1-CSB-PA884440LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against POLR3F. Recognizes POLR3F from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
POLR3F Antibody, FITC conjugated |
1-CSB-PA884440LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against POLR3F. Recognizes POLR3F from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
POLR3F Antibody, Biotin conjugated |
1-CSB-PA884440LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against POLR3F. Recognizes POLR3F from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Mouse POLR3F shRNA Plasmid |
20-abx977203 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
POLR3F Polyclonal Conjugated Antibody |
C27655 |
SAB |
100ul |
EUR 397 |
Human POLR3F shRNA Plasmid |
20-abx957233 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
POLR3F Recombinant Protein (Human) |
RP024124 |
ABM |
100 ug |
Ask for price |
POLR3F Recombinant Protein (Mouse) |
RP163421 |
ABM |
100 ug |
Ask for price |
POLR3F Recombinant Protein (Rat) |
RP221387 |
ABM |
100 ug |
Ask for price |
POLR3F Polyclonal Antibody, Biotin Conjugated |
A60347 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
POLR3F Polyclonal Antibody, FITC Conjugated |
A60348 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
POLR3F Polyclonal Antibody, HRP Conjugated |
A60349 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
Polr3f ORF Vector (Rat) (pORF) |
ORF073797 |
ABM |
1.0 ug DNA |
EUR 506 |
POLR3F ORF Vector (Human) (pORF) |
ORF008042 |
ABM |
1.0 ug DNA |
EUR 95 |
Polr3f ORF Vector (Mouse) (pORF) |
ORF054475 |
ABM |
1.0 ug DNA |
EUR 506 |
cDNA Synthesis SuperMix |
20-abx09801420ulSystems |
Abbexa |
|
-
100 rxns × 20 ul Systems
-
50 rxns × 20 ul Systems
|
- Shipped within 5-10 working days.
|
Evo? cDNA Supermix |
M1168-100 |
Biovision |
|
EUR 381 |
Evo? cDNA Supermix |
M1168-25 |
Biovision |
|
EUR 267 |
Novo? cDNA Supermix |
M1169-100 |
Biovision |
|
EUR 441 |
Novo? cDNA Supermix |
M1169-25 |
Biovision |
|
EUR 289 |
cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis |
C1634310 |
Biochain |
40 reactions |
EUR 621 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Corn |
C1634330 |
Biochain |
40 reactions |
EUR 621 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Orange |
C1634340 |
Biochain |
40 reactions |
EUR 621 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Potato |
C1634350 |
Biochain |
40 reactions |
EUR 621 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Rice |
C1634360 |
Biochain |
40 reactions |
EUR 621 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Wheat |
C1634390 |
Biochain |
40 reactions |
EUR 621 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
Polr3f sgRNA CRISPR Lentivector set (Rat) |
K6496101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Polr3f sgRNA CRISPR Lentivector set (Mouse) |
K4059301 |
ABM |
3 x 1.0 ug |
EUR 339 |
POLR3F sgRNA CRISPR Lentivector set (Human) |
K1685001 |
ABM |
3 x 1.0 ug |
EUR 339 |
First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb) |
20-abx09801620ulSystems |
Abbexa |
|
-
100 rxns × 20 ul Systems
-
50 rxns × 20 ul Systems
|
- Shipped within 5-10 working days.
|
First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb) |
20-abx09802120ulSystems |
Abbexa |
|
-
100 rxns × 20 ul Systems
-
50 rxns × 20 ul Systems
|
- Shipped within 5-10 working days.
|
cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean |
C1634370 |
Biochain |
40 reactions |
EUR 621 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA Probe Diluent Solution |
AR0063 |
BosterBio |
5mL |
EUR 106 |
cDNA from Arteriosclerosis: Aorta |
C1236012Hd-4 |
Biochain |
40 reactions |
EUR 811 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from hypertension: Artery |
C1236013Hd-2 |
Biochain |
40 reactions |
EUR 668 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Arteriosclerosis: Artery |
C1236013Hd-4 |
Biochain |
40 reactions |
EUR 811 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from hypertension: Vein |
C1236020Hd-2 |
Biochain |
40 reactions |
EUR 668 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Colon |
C1236090Lup |
Biochain |
40 reactions |
EUR 668 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from hypertension: Heart |
C1236122Hd-2 |
Biochain |
40 reactions |
EUR 668 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Heart |
C1236122Lup |
Biochain |
40 reactions |
EUR 668 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from hypertension: Kidney |
C1236142Hd-2 |
Biochain |
40 reactions |
EUR 668 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Kidney |
C1236142Lup |
Biochain |
40 reactions |
EUR 668 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Liver |
C1236149Lup |
Biochain |
40 reactions |
EUR 668 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Asthma: Lung |
C1236152Ld-1 |
Biochain |
40 reactions |
EUR 811 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Bronchitis: Lung |
C1236152Ld-2 |
Biochain |
40 reactions |
EUR 811 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Emphysema: Lung |
C1236152Ld-3 |
Biochain |
40 reactions |
EUR 811 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Pneumonia: Lung |
C1236152Ld-4 |
Biochain |
40 reactions |
EUR 811 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Lung |
C1236152Lup |
Biochain |
40 reactions |
EUR 668 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Pancreas |
C1236188Lup |
Biochain |
40 reactions |
EUR 668 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Spleen |
C1236246Lup |
Biochain |
40 reactions |
EUR 668 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: stomach |
C1236248Lup |
Biochain |
40 reactions |
EUR 668 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
Tetro cDNA Synthesis Kit |
BIO-65042 |
Bioline |
30 Reactions |
Ask for price |
Tetro cDNA Synthesis Kit |
BIO-65043 |
Bioline |
100 Reactions |
Ask for price |
SensiFAST cDNA Synthesis Kit |
BIO-65053 |
Bioline |
50 Reactions |
Ask for price |
SensiFAST cDNA Synthesis Kit |
BIO-65053/S |
Bioline |
Sample |
Ask for price |
SensiFAST cDNA Synthesis Kit |
BIO-65054 |
Bioline |
250 Reactions |
Ask for price |
OneScriptPlus cDNA Synthesis Kit |
G235 |
ABM |
25 x 20 ul reactions |
EUR 97 |
OneScriptPlus cDNA Synthesis Kit |
G236 |
ABM |
100 x 20 ul reactions |
EUR 169 |
OneScriptPlus cDNA Synthesis SuperMix |
G453 |
ABM |
25 x 20 ul reactions |
EUR 97 |
OneScriptPlus cDNA Synthesis SuperMix |
G454 |
ABM |
100 x 20 ul reactions |
EUR 169 |
circRNA cDNA Synthesis Kit |
G627 |
ABM |
25 rxn (20 ul/rxn) |
EUR 309 |
Novo? Transcriptome cDNA Kit |
M1167-100 |
Biovision |
|
EUR 952 |
Novo? Transcriptome cDNA Kit |
M1167-25 |
Biovision |
|
EUR 441 |
RNA Polymerase III Subunit F (POLR3F) Antibody |
20-abx008320 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
RNA Polymerase III Subunit F (POLR3F) Antibody |
20-abx114612 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RNA Polymerase III Subunit F (POLR3F) Antibody |
20-abx126392 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
RNA Polymerase III Subunit F (POLR3F) Antibody |
abx236632-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
RNA Polymerase III Subunit F (POLR3F) Antibody |
20-abx302688 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Polr3f sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6496102 |
ABM |
1.0 ug DNA |
EUR 154 |
Polr3f sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6496103 |
ABM |
1.0 ug DNA |
EUR 154 |
Polr3f sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6496104 |
ABM |
1.0 ug DNA |
EUR 154 |
Polr3f sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4059302 |
ABM |
1.0 ug DNA |
EUR 154 |
Polr3f sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4059303 |
ABM |
1.0 ug DNA |
EUR 154 |
Polr3f sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4059304 |
ABM |
1.0 ug DNA |
EUR 154 |
POLR3F sgRNA CRISPR Lentivector (Human) (Target 1) |
K1685002 |
ABM |
1.0 ug DNA |
EUR 154 |
POLR3F sgRNA CRISPR Lentivector (Human) (Target 2) |
K1685003 |
ABM |
1.0 ug DNA |
EUR 154 |
POLR3F sgRNA CRISPR Lentivector (Human) (Target 3) |
K1685004 |
ABM |
1.0 ug DNA |
EUR 154 |
POLR3F Protein Vector (Rat) (pPB-C-His) |
PV295186 |
ABM |
500 ng |
EUR 603 |
POLR3F Protein Vector (Rat) (pPB-N-His) |
PV295187 |
ABM |
500 ng |
EUR 603 |
POLR3F Protein Vector (Rat) (pPM-C-HA) |
PV295188 |
ABM |
500 ng |
EUR 603 |
POLR3F Protein Vector (Rat) (pPM-C-His) |
PV295189 |
ABM |
500 ng |
EUR 603 |
POLR3F Protein Vector (Human) (pPB-C-His) |
PV032165 |
ABM |
500 ng |
EUR 329 |
POLR3F Protein Vector (Human) (pPB-N-His) |
PV032166 |
ABM |
500 ng |
EUR 329 |
POLR3F Protein Vector (Human) (pPM-C-HA) |
PV032167 |
ABM |
500 ng |
EUR 329 |
The info point out that in cells missing RNA-DNA hybrid and Ty1 repressors, elevated ranges of RNA-cDNA hybrids, that are related to duplex nucleic acid constructions, increase Ty1 mobility by way of a Rad52-dependent mechanism. In distinction, in cells missing RNA-DNA hybrid repressors alone, elevated ranges of RNA-cDNA hybrids, that are related to triplex nucleic acid constructions, increase Ty1 mobility by way of a Rad52-independent course of. We suggest that duplex and triplex RNA-DNA hybrids promote transposon mobility by way of Rad52-dependent or -independent mechanisms.
Leave a Comment