A non-radioactive, improved PAR-CLIP and small RNA cDNA library preparation protocol

Crosslinking and immunoprecipitation (CLIP) strategies are highly effective strategies to interrogate direct protein-RNA interactions and dissect posttranscriptional gene regulatory networks. One broadly used CLIP variant is photoactivatable ribonucleoside enhanced CLIP (PAR-CLIP) that entails in vivo labeling of nascent RNAs with the photoreactive nucleosides 4-thiouridine (4SU) or 6-thioguanosine (6SG), which might effectively crosslink to interacting proteins utilizing UVA and UVB mild.

Crosslinking of 4SU or 6SG to interacting amino acids adjustments their base-pairing properties and leads to attribute mutations in cDNA libraries ready for high-throughput sequencing, which could be computationally exploited to take away ample background from non-crosslinked sequences and assist pinpoint RNA binding protein binding websites at nucleotide decision on a transcriptome-wide scale.

Right here we current a streamlined protocol for fluorescence-based PAR-CLIP (fPAR-CLIP) that eliminates the necessity to use radioactivity. It’s primarily based on direct ligation of a fluorescently labeled adapter to the three’finish of crosslinked RNA on immobilized ribonucleoproteins, adopted by isolation of the adapter-ligated RNA and environment friendly conversion into cDNA with out the beforehand wanted measurement fractionation on denaturing polyacrylamide gels. These enhancements reduce the experimentation by half to 2 days and will increase sensitivity by 10-100-fold.

Characterization and evaluation of the transcriptome response to drought in Larix kaempferi utilizing PacBio full-length cDNA sequencing built-in with de novo RNA-seq reads

A hypothetical mannequin of drought tolerance mechanism of Larix kaempferi was established via SMRT-seq and Illumina HiSeq. Larix kaempferi is a vital financial and ecological species and a significant afforestation species in north-eastern China. Up to now, no info has been reliably derived concerning full-length cDNA sequencing info on L. kaempferi. By single-molecule long-read isoform sequencing (SMRT-seq), right here we report a complete of 26,153,342 subreads (21.24 Gb) and 330,371 round consensus sequence (CCS) reads after the modification of web site mismatch, and 35,414 unigenes have been efficiently collected.

To achieve deeper insights into the molecular mechanisms of L. kaempferi response to drought stress, we mixed Illumina HiSeq with SMRT-seq to decode full-length transcripts. On this examine, we report 27 differentially expressed genes (DEGs) concerned within the notion and transmission of drought stress indicators in L. kaempferi.

Numerous DEGs responding to drought stress have been detected in L. kaempferi, particularly DEGs concerned within the reactive oxygen species (ROS) scavenging, lignin biosynthesis, and sugar metabolism, and DEGs encoding drought stress proteins. We detected 73 transcription components (TFs) below drought stress, together with AP2/ERF, bZIP, TCP, and MYB. This examine offers primary full sequence sources for L. kaempferi analysis and can assist us to raised perceive the capabilities of drought-resistance genes in L. kaempferi.

A non-radioactive, improved PAR-CLIP and small RNA cDNA library preparation protocol

cDNA-derived RNA phage meeting reveals important residues within the maturation protein of the Pseudomonas aeruginosa leviphage, PP7

PP7 is a leviphage with single-stranded RNA genome, which infects Pseudomonas aeruginosa PAO1. A reverse genetic system for PP7 was beforehand created through the use of reverse-transcribed cDNA (PP7O) from virion-derived RNA genome. Right here, we’ve discovered that the PP7O cDNA contained 20 nucleotide variations from the PP7 genome sequence deposited within the database.

We created one other reverse genetic system exploiting chemically synthesized cDNA (PP7S) primarily based on the database sequence. In contrast to PP7O that rendered infectious PP7 virions, PP7S-derived particles have been incapable of plaque formation on PAO1 cells, which was restored on the PAO1 cells expressing the maturation protein (MP) from PP7O Utilizing this reverse genetic system, we revealed two amino acid residues concerned within the identified roles of MP (i.e. adsorption and genome replication), fortuitously offering a lesson that the viral RNA genome sequencing wants purposeful verification presumably by a reverse genetic system.

IMPORTANCE Organic significance of RNA phages has been largely ignored, mockingly as a result of few research have been specializing in RNA phages. As an preliminary try to correctly signify RNA phages within the phageome, we beforehand created, through the use of reverse-transcribed cDNA, a reverse genetic system for the small RNA phage, PP7 that infects the opportunistic human pathogen, Pseudomonas aeruginosa We right here report one other system through the use of chemically synthesized cDNA primarily based on the database genome that has 20 nucleotide variations from the earlier cDNA.

Investigation of these cDNA-derived phage virions unveiled that two amino acids of the maturation protein are essential for the traditional phage lifecycle at totally different steps. Our examine offers an perception into the molecular foundation for the RNA phage lifecycle and a lesson that the RNA genome sequencing must be rigorously validated by cDNA-based phage meeting methods.

RNAcDNA hybrids mediate transposition by way of totally different mechanisms

Retrotransposons can signify half of eukaryotic genomes. Retrotransposon dysregulation destabilizes genomes and has been linked to varied human ailments. Rising regulators of retromobility embrace RNA-DNA hybrid-containing constructions generally known as R-loops. Accumulation of those constructions on the transposons of yeast 1 (Ty1) parts has been proven to extend Ty1 retromobility via an unknown mechanism. Right here, by way of a focused genetic display screen, we recognized the rnh1Δ rad27Δ yeast mutant, which lacked each the Ty1 inhibitor Rad27 and the RNA-DNA hybrid suppressor Rnh1.

The mutant exhibited elevated ranges of Ty1 cDNA-associated RNA-DNA hybrids that promoted Ty1 mobility. Furthermore, on this rnh1Δ rad27Δ mutant, however not within the double RNase H mutant rnh1Δ rnh201Δ, RNA-DNA hybrids preferentially existed as duplex nucleic acid constructions and elevated Ty1 mobility in a Rad52-dependent method.

POLR3F Antibody

24726-100ul 100ul
EUR 390

POLR3F antibody

70R-19415 50 ul
EUR 435
Description: Rabbit polyclonal POLR3F antibody

POLR3F antibody

70R-2038 50 ug
EUR 467
Description: Rabbit polyclonal POLR3F antibody raised against the middle region of POLR3F

POLR3F Antibody

1-CSB-PA884440LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POLR3F. Recognizes POLR3F from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

POLR3F Antibody

1-CSB-PA018348GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against POLR3F. Recognizes POLR3F from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti-POLR3F

YF-PA17105 50 ug
EUR 363
Description: Mouse polyclonal to POLR3F

anti-POLR3F

YF-PA17106 100 ug
EUR 403
Description: Rabbit polyclonal to POLR3F

anti- POLR3F antibody

FNab06632 100µg
EUR 548.75
  • Immunogen: polymerase(RNA) III(DNA directed) polypeptide F, 39 kDa
  • Uniprot ID: Q9H1D9
  • Gene ID: 10621
  • Research Area: Immunology, Metabolism
Description: Antibody raised against POLR3F

POLR3F Blocking Peptide

20-abx063691
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

POLR3F Rabbit pAb

A12224-100ul 100 ul
EUR 308

POLR3F Rabbit pAb

A12224-200ul 200 ul
EUR 459

POLR3F Rabbit pAb

A12224-20ul 20 ul
EUR 183

POLR3F Rabbit pAb

A12224-50ul 50 ul
EUR 223

POLR3F Polyclonal Antibody

A60346 100 µg
EUR 570.55
Description: kits suitable for this type of research

POLR3F Blocking Peptide

33R-5238 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of POLR3F antibody, catalog no. 70R-2038

POLR3F Blocking Peptide

33R-5647 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of POLR3F antibody, catalog no. 70R-2962

POLR3F Polyclonal Antibody

27655-100ul 100ul
EUR 252

POLR3F Polyclonal Antibody

27655-50ul 50ul
EUR 187

POLR3F cloning plasmid

CSB-CL884440HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 951
  • Sequence: atggcggaggtgaaggtgaaggtgcagccgcctgacgcggatccggtcgaaatagaaaacaggattatagaattatgtcaccagttccctcatggaatcacagaccaagtaattcagaatgaaatgcctcatatagaagcccagcagcgggcagtagccatcaataggttgttgtc
  • Show more
Description: A cloning plasmid for the POLR3F gene.

Anti-POLR3F antibody

PAab06632 100 ug
EUR 386

Anti-POLR3F antibody

STJ114115 100 µl
EUR 277
Description: The protein encoded by this gene is one of more than a dozen subunits forming eukaryotic RNA polymerase III (RNA Pol III), which transcribes 5S ribosomal RNA and tRNA genes. This protein has been shown to bind both TFIIIB90 and TBP, two subunits of RNA polymerase III transcription initiation factor IIIB (TFIIIB). Unlike most of the other RNA Pol III subunits, the encoded protein is unique to this polymerase. Alternative splicing results in multiple transcript variants.

POLR3F Polyclonal Conjugated Antibody

C27655 100ul
EUR 397

Mouse POLR3F shRNA Plasmid

20-abx977203
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Bovine POLR3F ELISA KIT

ELI-14353b 96 Tests
EUR 928

Mouse Polr3f ELISA KIT

ELI-14354m 96 Tests
EUR 865

POLR3F ELISA KIT|Human

EF001942 96 Tests
EUR 689

Human POLR3F ELISA KIT

ELI-53168h 96 Tests
EUR 824

Human POLR3F shRNA Plasmid

20-abx957233
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

POLR3F protein (His tag)

30R-2961 100 ug
EUR 322
Description: Purified recombinant Human POLR3F protein (His tag)

POLR3F Antibody, HRP conjugated

1-CSB-PA884440LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POLR3F. Recognizes POLR3F from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

POLR3F Antibody, FITC conjugated

1-CSB-PA884440LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POLR3F. Recognizes POLR3F from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

POLR3F Antibody, Biotin conjugated

1-CSB-PA884440LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POLR3F. Recognizes POLR3F from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

POLR3F Recombinant Protein (Human)

RP024124 100 ug Ask for price

POLR3F Recombinant Protein (Rat)

RP221387 100 ug Ask for price

POLR3F Recombinant Protein (Mouse)

RP163421 100 ug Ask for price

POLR3F Polyclonal Antibody, Biotin Conjugated

A60347 100 µg
EUR 570.55
Description: fast delivery possible

POLR3F Polyclonal Antibody, FITC Conjugated

A60348 100 µg
EUR 570.55
Description: reagents widely cited

POLR3F Polyclonal Antibody, HRP Conjugated

A60349 100 µg
EUR 570.55
Description: Ask the seller for details

POLR3F ORF Vector (Human) (pORF)

ORF008042 1.0 ug DNA
EUR 95

Polr3f ORF Vector (Rat) (pORF)

ORF073797 1.0 ug DNA
EUR 506

Polr3f ORF Vector (Mouse) (pORF)

ORF054475 1.0 ug DNA
EUR 506

cDNA Synthesis SuperMix

20-abx09801420ulSystems
  • EUR 565.00
  • EUR 481.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

Evo? cDNA Kit

M1164-100
EUR 294

Evo? cDNA Kit

M1164-25
EUR 234

Novo? cDNA Kit

M1165-100
EUR 354

Novo? cDNA Kit

M1165-25
EUR 267

Evo? cDNA Supermix

M1168-100
EUR 381

Evo? cDNA Supermix

M1168-25
EUR 267

Novo? cDNA Supermix

M1169-100
EUR 441

Novo? cDNA Supermix

M1169-25
EUR 289

cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis

C1634310 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Corn

C1634330 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Orange

C1634340 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Potato

C1634350 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Rice

C1634360 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Wheat

C1634390 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

POLR3F sgRNA CRISPR Lentivector set (Human)

K1685001 3 x 1.0 ug
EUR 339

Polr3f sgRNA CRISPR Lentivector set (Mouse)

K4059301 3 x 1.0 ug
EUR 339

Polr3f sgRNA CRISPR Lentivector set (Rat)

K6496101 3 x 1.0 ug
EUR 339

cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean

C1634370 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)

20-abx09801620ulSystems
  • EUR 620.00
  • EUR 523.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)

20-abx09802120ulSystems
  • EUR 871.00
  • EUR 662.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

cDNA Probe Diluent Solution

AR0063 5mL
EUR 106

Tetro cDNA Synthesis Kit

BIO-65042 30 Reactions Ask for price

Tetro cDNA Synthesis Kit

BIO-65043 100 Reactions Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65053 50 Reactions Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65053/S Sample Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65054 250 Reactions Ask for price

cDNA from Arteriosclerosis: Aorta

C1236012Hd-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Artery

C1236013Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Arteriosclerosis: Artery

C1236013Hd-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Vein

C1236020Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Colon

C1236090Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart

C1236122Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Heart

C1236122Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Kidney

C1236142Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Kidney

C1236142Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Liver

C1236149Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Asthma: Lung

C1236152Ld-1 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Bronchitis: Lung

C1236152Ld-2 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Emphysema: Lung

C1236152Ld-3 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Pneumonia: Lung

C1236152Ld-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Lung

C1236152Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Pancreas

C1236188Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Spleen

C1236246Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: stomach

C1236248Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

OneScriptPlus cDNA Synthesis Kit

G235 25 x 20 ul reactions
EUR 97

OneScriptPlus cDNA Synthesis Kit

G236 100 x 20 ul reactions
EUR 169

OneScriptPlus cDNA Synthesis SuperMix

G453 25 x 20 ul reactions
EUR 97

OneScriptPlus cDNA Synthesis SuperMix

G454 100 x 20 ul reactions
EUR 169

circRNA cDNA Synthesis Kit

G627 25 rxn (20 ul/rxn)
EUR 309

Human eNOS cDNA probe

eNOS51-D-2 2 ug
EUR 445

Plant Tissue cDNA: Arabidopsis

PC34-310 10 rxn
EUR 415

Novo? Transcriptome cDNA Kit

M1167-100
EUR 952

Novo? Transcriptome cDNA Kit

M1167-25
EUR 441

RNA Polymerase III Subunit F (POLR3F) Antibody

20-abx126392
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

RNA Polymerase III Subunit F (POLR3F) Antibody

20-abx114612
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

RNA Polymerase III Subunit F (POLR3F) Antibody

20-abx008320
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

RNA Polymerase III Subunit F (POLR3F) Antibody

abx236632-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

RNA Polymerase III Subunit F (POLR3F) Antibody

20-abx302688
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

POLR3F sgRNA CRISPR Lentivector (Human) (Target 1)

K1685002 1.0 ug DNA
EUR 154

POLR3F sgRNA CRISPR Lentivector (Human) (Target 2)

K1685003 1.0 ug DNA
EUR 154

POLR3F sgRNA CRISPR Lentivector (Human) (Target 3)

K1685004 1.0 ug DNA
EUR 154

Polr3f sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4059302 1.0 ug DNA
EUR 154

Polr3f sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4059303 1.0 ug DNA
EUR 154

Polr3f sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4059304 1.0 ug DNA
EUR 154

Polr3f sgRNA CRISPR Lentivector (Rat) (Target 1)

K6496102 1.0 ug DNA
EUR 154

Polr3f sgRNA CRISPR Lentivector (Rat) (Target 2)

K6496103 1.0 ug DNA
EUR 154

Polr3f sgRNA CRISPR Lentivector (Rat) (Target 3)

K6496104 1.0 ug DNA
EUR 154

Recombinant Human POLR3F Protein, His, E.coli-1mg

QP13106-1mg 1mg
EUR 2757

Recombinant Human POLR3F Protein, His, E.coli-20ug

QP13106-20ug 20ug
EUR 201

Recombinant Human POLR3F Protein, His, E.coli-5ug

QP13106-5ug 5ug
EUR 155

POLR3F Protein Vector (Human) (pPB-C-His)

PV032165 500 ng
EUR 329

POLR3F Protein Vector (Human) (pPB-N-His)

PV032166 500 ng
EUR 329

POLR3F Protein Vector (Human) (pPM-C-HA)

PV032167 500 ng
EUR 329

POLR3F Protein Vector (Human) (pPM-C-His)

PV032168 500 ng
EUR 329

The info point out that in cells missing RNA-DNA hybrid and Ty1 repressors, elevated ranges of RNA-cDNA hybrids, that are related to duplex nucleic acid constructions, increase Ty1 mobility by way of a Rad52-dependent mechanism. In distinction, in cells missing RNA-DNA hybrid repressors alone, elevated ranges of RNA-cDNA hybrids, that are related to triplex nucleic acid constructions, increase Ty1 mobility by way of a Rad52-independent course of. We suggest that duplex and triplex RNA-DNA hybrids promote transposon mobility by way of Rad52-dependent or -independent mechanisms.

Leave a Comment