A non-radioactive, improved PAR-CLIP and small RNA cDNA library preparation protocol

Crosslinking and immunoprecipitation (CLIP) strategies are highly effective strategies to interrogate direct protein-RNA interactions and dissect posttranscriptional gene regulatory networks. One broadly used CLIP variant is photoactivatable ribonucleoside enhanced CLIP (PAR-CLIP) that entails in vivo labeling of nascent RNAs with the photoreactive nucleosides 4-thiouridine (4SU) or 6-thioguanosine (6SG), which might effectively crosslink to interacting proteins utilizing UVA and UVB mild.

Crosslinking of 4SU or 6SG to interacting amino acids adjustments their base-pairing properties and leads to attribute mutations in cDNA libraries ready for high-throughput sequencing, which could be computationally exploited to take away ample background from non-crosslinked sequences and assist pinpoint RNA binding protein binding websites at nucleotide decision on a transcriptome-wide scale.

Right here we current a streamlined protocol for fluorescence-based PAR-CLIP (fPAR-CLIP) that eliminates the necessity to use radioactivity. It’s primarily based on direct ligation of a fluorescently labeled adapter to the three’finish of crosslinked RNA on immobilized ribonucleoproteins, adopted by isolation of the adapter-ligated RNA and environment friendly conversion into cDNA with out the beforehand wanted measurement fractionation on denaturing polyacrylamide gels. These enhancements reduce the experimentation by half to 2 days and will increase sensitivity by 10-100-fold.

Characterization and evaluation of the transcriptome response to drought in Larix kaempferi utilizing PacBio full-length cDNA sequencing built-in with de novo RNA-seq reads

A hypothetical mannequin of drought tolerance mechanism of Larix kaempferi was established via SMRT-seq and Illumina HiSeq. Larix kaempferi is a vital financial and ecological species and a significant afforestation species in north-eastern China. Up to now, no info has been reliably derived concerning full-length cDNA sequencing info on L. kaempferi. By single-molecule long-read isoform sequencing (SMRT-seq), right here we report a complete of 26,153,342 subreads (21.24 Gb) and 330,371 round consensus sequence (CCS) reads after the modification of web site mismatch, and 35,414 unigenes have been efficiently collected.

To achieve deeper insights into the molecular mechanisms of L. kaempferi response to drought stress, we mixed Illumina HiSeq with SMRT-seq to decode full-length transcripts. On this examine, we report 27 differentially expressed genes (DEGs) concerned within the notion and transmission of drought stress indicators in L. kaempferi.

Numerous DEGs responding to drought stress have been detected in L. kaempferi, particularly DEGs concerned within the reactive oxygen species (ROS) scavenging, lignin biosynthesis, and sugar metabolism, and DEGs encoding drought stress proteins. We detected 73 transcription components (TFs) below drought stress, together with AP2/ERF, bZIP, TCP, and MYB. This examine offers primary full sequence sources for L. kaempferi analysis and can assist us to raised perceive the capabilities of drought-resistance genes in L. kaempferi.

cDNA-derived RNA phage meeting reveals important residues within the maturation protein of the Pseudomonas aeruginosa leviphage, PP7

PP7 is a leviphage with single-stranded RNA genome, which infects Pseudomonas aeruginosa PAO1. A reverse genetic system for PP7 was beforehand created through the use of reverse-transcribed cDNA (PP7_O) from virion-derived RNA genome. Right here, we’ve discovered that the PP7_O cDNA contained 20 nucleotide variations from the PP7 genome sequence deposited within the database.

We created one other reverse genetic system exploiting chemically synthesized cDNA (PP7_S) primarily based on the database sequence. In contrast to PP7_O that rendered infectious PP7 virions, PP7_S-derived particles have been incapable of plaque formation on PAO1 cells, which was restored on the PAO1 cells expressing the maturation protein (MP) from PP7_O Utilizing this reverse genetic system, we revealed two amino acid residues concerned within the identified roles of MP (i.e. adsorption and genome replication), fortuitously offering a lesson that the viral RNA genome sequencing wants purposeful verification presumably by a reverse genetic system.

IMPORTANCE Organic significance of RNA phages has been largely ignored, mockingly as a result of few research have been specializing in RNA phages. As an preliminary try to correctly signify RNA phages within the phageome, we beforehand created, through the use of reverse-transcribed cDNA, a reverse genetic system for the small RNA phage, PP7 that infects the opportunistic human pathogen, Pseudomonas aeruginosa We right here report one other system through the use of chemically synthesized cDNA primarily based on the database genome that has 20 nucleotide variations from the earlier cDNA.

Investigation of these cDNA-derived phage virions unveiled that two amino acids of the maturation protein are essential for the traditional phage lifecycle at totally different steps. Our examine offers an perception into the molecular foundation for the RNA phage lifecycle and a lesson that the RNA genome sequencing must be rigorously validated by cDNA-based phage meeting methods.

RNA–cDNA hybrids mediate transposition by way of totally different mechanisms

Retrotransposons can signify half of eukaryotic genomes. Retrotransposon dysregulation destabilizes genomes and has been linked to varied human ailments. Rising regulators of retromobility embrace RNA-DNA hybrid-containing constructions generally known as R-loops. Accumulation of those constructions on the transposons of yeast 1 (Ty1) parts has been proven to extend Ty1 retromobility via an unknown mechanism. Right here, by way of a focused genetic display screen, we recognized the rnh1Δ rad27Δ yeast mutant, which lacked each the Ty1 inhibitor Rad27 and the RNA-DNA hybrid suppressor Rnh1.

The mutant exhibited elevated ranges of Ty1 cDNA-associated RNA-DNA hybrids that promoted Ty1 mobility. Furthermore, on this rnh1Δ rad27Δ mutant, however not within the double RNase H mutant rnh1Δ rnh201Δ, RNA-DNA hybrids preferentially existed as duplex nucleic acid constructions and elevated Ty1 mobility in a Rad52-dependent method.

POLR3F Antibody
24726-100ul	SAB	100ul	EUR 390

POLR3F antibody
70R-19415	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal POLR3F antibody

POLR3F antibody
70R-2038	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal POLR3F antibody raised against the middle region of POLR3F

POLR3F Antibody
1-CSB-PA884440LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POLR3F. Recognizes POLR3F from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

POLR3F Antibody
1-CSB-PA018348GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against POLR3F. Recognizes POLR3F from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti-POLR3F
YF-PA17105	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to POLR3F

anti-POLR3F
YF-PA17106	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to POLR3F

anti- POLR3F antibody
FNab06632	FN Test	100µg	EUR 548.75
Immunogen: polymerase(RNA) III(DNA directed) polypeptide F, 39 kDa Uniprot ID: Q9H1D9 Gene ID: 10621 Research Area: Immunology, Metabolism
Description: Antibody raised against POLR3F

POLR3F Blocking Peptide
20-abx063691	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

POLR3F Rabbit pAb
A12224-100ul	Abclonal	100 ul	EUR 308

POLR3F Rabbit pAb
A12224-200ul	Abclonal	200 ul	EUR 459

POLR3F Rabbit pAb
A12224-20ul	Abclonal	20 ul	EUR 183

POLR3F Rabbit pAb
A12224-50ul	Abclonal	50 ul	EUR 223

POLR3F Polyclonal Antibody
A60346	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

POLR3F Blocking Peptide
33R-5238	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of POLR3F antibody, catalog no. 70R-2038

POLR3F Blocking Peptide
33R-5647	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of POLR3F antibody, catalog no. 70R-2962

POLR3F Polyclonal Antibody
27655-100ul	SAB	100ul	EUR 252

POLR3F Polyclonal Antibody
27655-50ul	SAB	50ul	EUR 187

POLR3F cloning plasmid
CSB-CL884440HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 951 Sequence: atggcggaggtgaaggtgaaggtgcagccgcctgacgcggatccggtcgaaatagaaaacaggattatagaattatgtcaccagttccctcatggaatcacagaccaagtaattcagaatgaaatgcctcatatagaagcccagcagcgggcagtagccatcaataggttgttgtc Show more
Description: A cloning plasmid for the POLR3F gene.

Anti-POLR3F antibody
PAab06632	Lifescience Market	100 ug	EUR 386

Anti-POLR3F antibody
STJ114115	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is one of more than a dozen subunits forming eukaryotic RNA polymerase III (RNA Pol III), which transcribes 5S ribosomal RNA and tRNA genes. This protein has been shown to bind both TFIIIB90 and TBP, two subunits of RNA polymerase III transcription initiation factor IIIB (TFIIIB). Unlike most of the other RNA Pol III subunits, the encoded protein is unique to this polymerase. Alternative splicing results in multiple transcript variants.

POLR3F Polyclonal Conjugated Antibody
C27655	SAB	100ul	EUR 397

Mouse POLR3F shRNA Plasmid
20-abx977203	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Bovine POLR3F ELISA KIT
ELI-14353b	Lifescience Market	96 Tests	EUR 928

Mouse Polr3f ELISA KIT
ELI-14354m	Lifescience Market	96 Tests	EUR 865

POLR3F ELISA KIT|Human
EF001942	Lifescience Market	96 Tests	EUR 689

Human POLR3F ELISA KIT
ELI-53168h	Lifescience Market	96 Tests	EUR 824

Human POLR3F shRNA Plasmid
20-abx957233	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

POLR3F protein (His tag)
30R-2961	Fitzgerald	100 ug	EUR 322
Description: Purified recombinant Human POLR3F protein (His tag)

POLR3F Antibody, HRP conjugated
1-CSB-PA884440LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POLR3F. Recognizes POLR3F from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

POLR3F Antibody, FITC conjugated
1-CSB-PA884440LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POLR3F. Recognizes POLR3F from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

POLR3F Antibody, Biotin conjugated
1-CSB-PA884440LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POLR3F. Recognizes POLR3F from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

POLR3F Recombinant Protein (Human)
RP024124	ABM	100 ug	Ask for price

POLR3F Recombinant Protein (Rat)
RP221387	ABM	100 ug	Ask for price

POLR3F Recombinant Protein (Mouse)
RP163421	ABM	100 ug	Ask for price

POLR3F Polyclonal Antibody, Biotin Conjugated
A60347	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

POLR3F Polyclonal Antibody, FITC Conjugated
A60348	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

POLR3F Polyclonal Antibody, HRP Conjugated
A60349	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

POLR3F ORF Vector (Human) (pORF)
ORF008042	ABM	1.0 ug DNA	EUR 95

Polr3f ORF Vector (Rat) (pORF)
ORF073797	ABM	1.0 ug DNA	EUR 506

Polr3f ORF Vector (Mouse) (pORF)
ORF054475	ABM	1.0 ug DNA	EUR 506

cDNA Synthesis SuperMix
20-abx09801420ulSystems	Abbexa	EUR 565.00 EUR 481.00	100 rxns × 20 ul Systems 50 rxns × 20 ul Systems
Shipped within 5-10 working days.

Evo? cDNA Kit
M1164-100	Biovision		EUR 294

Evo? cDNA Kit
M1164-25	Biovision		EUR 234

Novo? cDNA Kit
M1165-100	Biovision		EUR 354

Novo? cDNA Kit
M1165-25	Biovision		EUR 267

Evo? cDNA Supermix
M1168-100	Biovision		EUR 381

Evo? cDNA Supermix
M1168-25	Biovision		EUR 267

Novo? cDNA Supermix
M1169-100	Biovision		EUR 441

Novo? cDNA Supermix
M1169-25	Biovision		EUR 289

cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis
C1634310	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Corn
C1634330	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Orange
C1634340	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Potato
C1634350	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Rice
C1634360	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Wheat
C1634390	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

POLR3F sgRNA CRISPR Lentivector set (Human)
K1685001	ABM	3 x 1.0 ug	EUR 339

Polr3f sgRNA CRISPR Lentivector set (Mouse)
K4059301	ABM	3 x 1.0 ug	EUR 339

Polr3f sgRNA CRISPR Lentivector set (Rat)
K6496101	ABM	3 x 1.0 ug	EUR 339

cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean
C1634370	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)
20-abx09801620ulSystems	Abbexa	EUR 620.00 EUR 523.00	100 rxns × 20 ul Systems 50 rxns × 20 ul Systems
Shipped within 5-10 working days.

First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)
20-abx09802120ulSystems	Abbexa	EUR 871.00 EUR 662.00	100 rxns × 20 ul Systems 50 rxns × 20 ul Systems
Shipped within 5-10 working days.

cDNA Probe Diluent Solution
AR0063	BosterBio	5mL	EUR 106

Tetro cDNA Synthesis Kit
BIO-65042	Bioline	30 Reactions	Ask for price

Tetro cDNA Synthesis Kit
BIO-65043	Bioline	100 Reactions	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65053	Bioline	50 Reactions	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65053/S	Bioline	Sample	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65054	Bioline	250 Reactions	Ask for price

cDNA from Arteriosclerosis: Aorta
C1236012Hd-4	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Artery
C1236013Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Arteriosclerosis: Artery
C1236013Hd-4	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Vein
C1236020Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Colon
C1236090Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart
C1236122Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Heart
C1236122Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Kidney
C1236142Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Kidney
C1236142Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Liver
C1236149Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Asthma: Lung
C1236152Ld-1	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Bronchitis: Lung
C1236152Ld-2	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Emphysema: Lung
C1236152Ld-3	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Pneumonia: Lung
C1236152Ld-4	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Lung
C1236152Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Pancreas
C1236188Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Spleen
C1236246Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: stomach
C1236248Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

OneScriptPlus cDNA Synthesis Kit
G235	ABM	25 x 20 ul reactions	EUR 97

OneScriptPlus cDNA Synthesis Kit
G236	ABM	100 x 20 ul reactions	EUR 169

OneScriptPlus cDNA Synthesis SuperMix
G453	ABM	25 x 20 ul reactions	EUR 97

OneScriptPlus cDNA Synthesis SuperMix
G454	ABM	100 x 20 ul reactions	EUR 169

circRNA cDNA Synthesis Kit
G627	ABM	25 rxn (20 ul/rxn)	EUR 309

Human eNOS cDNA probe
eNOS51-D-2	Alpha Diagnostics	2 ug	EUR 445

Plant Tissue cDNA: Arabidopsis
PC34-310	Alpha Diagnostics	10 rxn	EUR 415

Novo? Transcriptome cDNA Kit
M1167-100	Biovision		EUR 952

Novo? Transcriptome cDNA Kit
M1167-25	Biovision		EUR 441

RNA Polymerase III Subunit F (POLR3F) Antibody
20-abx126392	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

RNA Polymerase III Subunit F (POLR3F) Antibody
20-abx114612	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

RNA Polymerase III Subunit F (POLR3F) Antibody
20-abx008320	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

RNA Polymerase III Subunit F (POLR3F) Antibody
abx236632-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

RNA Polymerase III Subunit F (POLR3F) Antibody
20-abx302688	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

POLR3F sgRNA CRISPR Lentivector (Human) (Target 1)
K1685002	ABM	1.0 ug DNA	EUR 154

POLR3F sgRNA CRISPR Lentivector (Human) (Target 2)
K1685003	ABM	1.0 ug DNA	EUR 154

POLR3F sgRNA CRISPR Lentivector (Human) (Target 3)
K1685004	ABM	1.0 ug DNA	EUR 154

Polr3f sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4059302	ABM	1.0 ug DNA	EUR 154

Polr3f sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4059303	ABM	1.0 ug DNA	EUR 154

Polr3f sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4059304	ABM	1.0 ug DNA	EUR 154

Polr3f sgRNA CRISPR Lentivector (Rat) (Target 1)
K6496102	ABM	1.0 ug DNA	EUR 154

Polr3f sgRNA CRISPR Lentivector (Rat) (Target 2)
K6496103	ABM	1.0 ug DNA	EUR 154

Polr3f sgRNA CRISPR Lentivector (Rat) (Target 3)
K6496104	ABM	1.0 ug DNA	EUR 154

Recombinant Human POLR3F Protein, His, E.coli-1mg
QP13106-1mg	EnQuireBio	1mg	EUR 2757

Recombinant Human POLR3F Protein, His, E.coli-20ug
QP13106-20ug	EnQuireBio	20ug	EUR 201

Recombinant Human POLR3F Protein, His, E.coli-5ug
QP13106-5ug	EnQuireBio	5ug	EUR 155

POLR3F Protein Vector (Human) (pPB-C-His)
PV032165	ABM	500 ng	EUR 329

POLR3F Protein Vector (Human) (pPB-N-His)
PV032166	ABM	500 ng	EUR 329

POLR3F Protein Vector (Human) (pPM-C-HA)
PV032167	ABM	500 ng	EUR 329

POLR3F Protein Vector (Human) (pPM-C-His)
PV032168	ABM	500 ng	EUR 329

The info point out that in cells missing RNA-DNA hybrid and Ty1 repressors, elevated ranges of RNA-cDNA hybrids, that are related to duplex nucleic acid constructions, increase Ty1 mobility by way of a Rad52-dependent mechanism. In distinction, in cells missing RNA-DNA hybrid repressors alone, elevated ranges of RNA-cDNA hybrids, that are related to triplex nucleic acid constructions, increase Ty1 mobility by way of a Rad52-independent course of. We suggest that duplex and triplex RNA-DNA hybrids promote transposon mobility by way of Rad52-dependent or -independent mechanisms.