The London airplane tree (Platanus acerifolia Willd.) has world significance as an city landscaping tree and is the topic of genetic-improvement applications for productive sterility, illness and/or insect resistance. Molecular evaluation methods are essential to such applications, however could also be impeded by particular difficulties encountered throughout nucleic acid isolation.
An in depth RNA isolation and purification protocol, primarily based on established cetyltrimethyl-ammonium bromide (CTAB) extraction methods mixed with extra purification steps utilizing butanol and the ionic detergent CTAB, which overcomes these issues within the woody species P. acerifolia, was carried out. Briefly, phenolic compounds are certain to soluble polyvinylpyrrolidone after which separated out by LiCl precipitation of the RNA. Subsequently, protein- and carbohydrate-contaminants are eliminated by chloroform partitioning adopted by LiCl-mediated precipitation.
The ensuing isolates of RNA had been discovered to be of adequate high quality for profitable use in reverse transcription PCR evaluation. Moreover, RNA isolates from feminine inflorescences had been used for the development of a cDNA library. This library was discovered to comprise a number of full-length cDNA clones of MADS-box genes, in line with the library being consultant of inflorescence expression profiles.
Transcriptome profiling of mouse samples utilizing nanopore sequencing of cDNA and RNA molecules.
Our imaginative and prescient of DNA transcription and splicing has modified dramatically with the introduction of short-read sequencing. These high-throughput sequencing applied sciences promised to unravel the complexity of any transcriptome. Typically gene expression ranges are well-captured utilizing these applied sciences, however there are nonetheless remaining caveats as a result of restricted learn size and the truth that RNA molecules needed to be reverse transcribed earlier than sequencing.
Oxford Nanopore Applied sciences has lately launched a transportable sequencer which provides the opportunity of sequencing lengthy reads and most significantly RNA molecules. Right here we generated a full mouse transcriptome from mind and liver utilizing the Oxford Nanopore machine. As a comparability, we sequenced RNA (RNA-Seq) and cDNA (cDNA-Seq) molecules utilizing each lengthy and quick reads applied sciences and examined the TeloPrime preparation package, devoted to the enrichment of full-length transcripts.
Utilizing spike-in knowledge, we confirmed that expression ranges are effectively captured by cDNA-Seq utilizing quick reads. Extra importantly, Oxford Nanopore RNA-Seq tends to be extra environment friendly, whereas cDNA-Seq seems to be extra biased. We additional present that the cDNA library preparation of the Nanopore protocol induces learn truncation for transcripts containing inside runs of T’s.

This bias is marked for runs of at the very least 15 T’s, however is already detectable for runs of at the very least 9 T’s and due to this fact considerations greater than 20% of expressed transcripts in mouse mind and liver. Lastly, we define that bioinformatics challenges stay forward for quantifying on the transcript stage, particularly when reads are usually not full-length. Correct quantification of repeat-associated genes equivalent to processed pseudogenes additionally stays troublesome, and we present that present mapping protocols which map reads to the genome largely over-estimate their expression, on the expense of their mother or father gene.
Rolling Circle cDNA Synthesis Uncovers Round RNA Splice Variants.
Excessive-throughput RNA sequencing and novel bioinformatic pipelines have recognized 1000’s of round (circ)RNAs containing backsplice junction sequences. Nevertheless, circRNAs generated from a number of exons might comprise totally different combos of exons and/or introns arising from different splicing, whereas the backsplice junction sequence is similar. To have the ability to establish circRNA splice variants, we developed a way termed circRNA-Rolling Circle Amplification (circRNA-RCA).
This methodology detects full-length circRNA sequences by performing reverse transcription (RT) within the absence of RNase H exercise, adopted by polymerase chain response (PCR) amplification of full-length circRNAs utilizing a ahead primer spanning the backsplice junction sequence and a reverse primer precisely upstream of the ahead primer.
By sequencing the PCR merchandise, circRNA splice variants bearing the identical backsplice junctions, which had been in any other case solely predicted computationally, may very well be experimentally validated. The splice variants had been additional predicted to affiliate with totally different subsets of goal RNA-binding proteins and microRNAs, supporting the notion that totally different circRNA splice variants can have totally different organic impacts. In sum, the circRNA-RCA methodology permits the correct identification of full-length circRNA sequences, providing distinctive perception into their particular person operate.
Methods for Changing RNA to Amplifiable cDNA for Single-Cell RNA Sequencing Strategies.
This overview describes the options of molecular biology methods for single-cell RNA sequencing (scRNA-seq), together with strategies developed in our laboratory. Current scRNA-seq strategies require the conversion of first-strand cDNA to amplifiable cDNA adopted by whole-transcript amplification. There are three major methods for this conversion: poly-A tagging, template switching, and RNase H-DNA polymerase I-mediated second-strand cDNA synthesis for in vitro transcription.
We focus on the deserves and limitations of those methods and describe our Reverse Transcription with Random Displacement Amplification know-how that permits for direct first-strand cDNA amplification from RNA with out the necessity for conversion to an amplifiable cDNA.
RNASE12 Antibody |
DF6217 |
Affbiotech |
200ul |
EUR 304 |
Description: RNASE12 Antibody detects endogenous levels of total RNASE12. |
RNASE12 Antibody |
CSB-PA019792KA01HU- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against RNASE12. Recognizes RNASE12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
RNASE12 Antibody |
CSB-PA019792KA01HU-100ul |
Cusabio |
100ul |
EUR 389 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against RNASE12. Recognizes RNASE12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
RNASE12 siRNA |
20-abx904594 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RNASE12 siRNA |
20-abx931614 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RNASE12 siRNA |
20-abx931615 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ribonuclease A12 (RNASE12) Polyclonal Antibody (Human) |
4-PAT642Hu01 |
Cloud-Clone |
-
EUR 262.00
-
EUR 2747.00
-
EUR 679.00
-
EUR 331.00
-
EUR 220.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RNASE12 (Glu21~Lys147)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Ribonuclease A12 (RNASE12) |
RNASE12 Rabbit pAb |
A1072-100ul |
Abclonal |
100 ul |
EUR 308 |
RNASE12 Rabbit pAb |
A1072-200ul |
Abclonal |
200 ul |
EUR 459 |
RNASE12 Rabbit pAb |
A1072-20ul |
Abclonal |
20 ul |
EUR 183 |
RNASE12 Rabbit pAb |
A1072-50ul |
Abclonal |
50 ul |
EUR 223 |
RNASE12 Rabbit pAb |
A14607-100ul |
Abclonal |
100 ul |
EUR 308 |
RNASE12 Rabbit pAb |
A14607-200ul |
Abclonal |
200 ul |
EUR 459 |
RNASE12 Rabbit pAb |
A14607-20ul |
Abclonal |
20 ul |
EUR 183 |
RNASE12 Rabbit pAb |
A14607-50ul |
Abclonal |
50 ul |
EUR 223 |
RNASE12 Rabbit pAb |
A14608-100ul |
Abclonal |
100 ul |
EUR 308 |
RNASE12 Rabbit pAb |
A14608-200ul |
Abclonal |
200 ul |
EUR 459 |
RNASE12 Rabbit pAb |
A14608-20ul |
Abclonal |
20 ul |
EUR 183 |
RNASE12 Rabbit pAb |
A14608-50ul |
Abclonal |
50 ul |
EUR 223 |
RNASE12 Blocking Peptide |
DF6217-BP |
Affbiotech |
1mg |
EUR 195 |
RNASE12 Conjugated Antibody |
C38175 |
SAB |
100ul |
EUR 397 |
RNASE12 cloning plasmid |
CSB-CL708031HU-10ug |
Cusabio |
10ug |
EUR 234 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 444
- Sequence: atgataataatggtgataattttcttggtgcttctgttctgggaaaatgaggtgaatgatgaagcagtgatgtcaactttagaacacttgcatgtggactaccctcagaatgacgttcccgttcctgcaaggtactgcaaccacatgatcatacaaagagttatcagggaacctga
- Show more
|
Description: A cloning plasmid for the RNASE12 gene. |
Ribonuclease A12 (RNASE12) Polyclonal Antibody (Human), APC |
4-PAT642Hu01-APC |
Cloud-Clone |
-
EUR 368.00
-
EUR 3599.00
-
EUR 993.00
-
EUR 472.00
-
EUR 229.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RNASE12 (Glu21~Lys147)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Ribonuclease A12 (RNASE12). This antibody is labeled with APC. |
Ribonuclease A12 (RNASE12) Polyclonal Antibody (Human), Biotinylated |
4-PAT642Hu01-Biotin |
Cloud-Clone |
-
EUR 328.00
-
EUR 2697.00
-
EUR 786.00
-
EUR 404.00
-
EUR 226.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RNASE12 (Glu21~Lys147)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Ribonuclease A12 (RNASE12). This antibody is labeled with Biotin. |
Ribonuclease A12 (RNASE12) Polyclonal Antibody (Human), Cy3 |
4-PAT642Hu01-Cy3 |
Cloud-Clone |
-
EUR 449.00
-
EUR 4757.00
-
EUR 1283.00
-
EUR 588.00
-
EUR 264.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RNASE12 (Glu21~Lys147)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Ribonuclease A12 (RNASE12). This antibody is labeled with Cy3. |
Ribonuclease A12 (RNASE12) Polyclonal Antibody (Human), FITC |
4-PAT642Hu01-FITC |
Cloud-Clone |
-
EUR 314.00
-
EUR 2899.00
-
EUR 814.00
-
EUR 397.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RNASE12 (Glu21~Lys147)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Ribonuclease A12 (RNASE12). This antibody is labeled with FITC. |
Ribonuclease A12 (RNASE12) Polyclonal Antibody (Human), HRP |
4-PAT642Hu01-HRP |
Cloud-Clone |
-
EUR 335.00
-
EUR 3135.00
-
EUR 877.00
-
EUR 426.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RNASE12 (Glu21~Lys147)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Ribonuclease A12 (RNASE12). This antibody is labeled with HRP. |
Ribonuclease A12 (RNASE12) Polyclonal Antibody (Human), PE |
4-PAT642Hu01-PE |
Cloud-Clone |
-
EUR 314.00
-
EUR 2899.00
-
EUR 814.00
-
EUR 397.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RNASE12 (Glu21~Lys147)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Ribonuclease A12 (RNASE12). This antibody is labeled with PE. |
Ribonuclease A12 (RNASE12) Antibody |
20-abx101918 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Ribonuclease A12 (RNASE12) Antibody |
abx117029-100ug |
Abbexa |
100 ug |
EUR 467 |
- Shipped within 5-10 working days.
|
Ribonuclease A12 (RNASE12) Antibody |
abx146450-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Rat RNASE12 shRNA Plasmid |
20-abx990586 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse RNASE12 shRNA Plasmid |
20-abx984097 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human RNASE12 shRNA Plasmid |
20-abx968360 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Ribonuclease A12 (RNASE12) Antibody |
20-abx000995 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
RNASE12 Recombinant Protein (Human) |
RP042925 |
ABM |
100 ug |
Ask for price |
RNASE12 Recombinant Protein (Mouse) |
RP168362 |
ABM |
100 ug |
Ask for price |
RNASE12 Recombinant Protein (Rat) |
RP226220 |
ABM |
100 ug |
Ask for price |
Ribonuclease A12 (RNASE12) Polyclonal Antibody (Human), APC-Cy7 |
4-PAT642Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 616.00
-
EUR 7078.00
-
EUR 1867.00
-
EUR 824.00
-
EUR 338.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RNASE12 (Glu21~Lys147)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Ribonuclease A12 (RNASE12). This antibody is labeled with APC-Cy7. |
Human Ribonuclease A12 (RNASE12) Protein |
20-abx068911 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2110.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Ribonuclease A12 (RNASE12) Antibody (Biotin) |
20-abx271884 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Rnase12 ORF Vector (Rat) (pORF) |
ORF075408 |
ABM |
1.0 ug DNA |
EUR 506 |
RNASE12 ORF Vector (Human) (pORF) |
ORF014309 |
ABM |
1.0 ug DNA |
EUR 354 |
Rnase12 ORF Vector (Mouse) (pORF) |
ORF056122 |
ABM |
1.0 ug DNA |
EUR 506 |
cDNA Synthesis SuperMix |
20-abx09801420ulSystems |
Abbexa |
|
-
100 rxns × 20 ul Systems
-
50 rxns × 20 ul Systems
|
- Shipped within 5-10 working days.
|
Evo? cDNA Supermix |
M1168-100 |
Biovision |
|
EUR 381 |
Evo? cDNA Supermix |
M1168-25 |
Biovision |
|
EUR 267 |
Novo? cDNA Supermix |
M1169-100 |
Biovision |
|
EUR 441 |
Novo? cDNA Supermix |
M1169-25 |
Biovision |
|
EUR 289 |
Rnase12 sgRNA CRISPR Lentivector set (Rat) |
K6296901 |
ABM |
3 x 1.0 ug |
EUR 339 |
RNASE12 sgRNA CRISPR Lentivector set (Human) |
K1832201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rnase12 sgRNA CRISPR Lentivector set (Mouse) |
K3570801 |
ABM |
3 x 1.0 ug |
EUR 339 |
cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis |
C1634310 |
Biochain |
40 reactions |
EUR 621 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Corn |
C1634330 |
Biochain |
40 reactions |
EUR 621 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Orange |
C1634340 |
Biochain |
40 reactions |
EUR 621 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Potato |
C1634350 |
Biochain |
40 reactions |
EUR 621 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Rice |
C1634360 |
Biochain |
40 reactions |
EUR 621 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Wheat |
C1634390 |
Biochain |
40 reactions |
EUR 621 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb) |
20-abx09801620ulSystems |
Abbexa |
|
-
100 rxns × 20 ul Systems
-
50 rxns × 20 ul Systems
|
- Shipped within 5-10 working days.
|
First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb) |
20-abx09802120ulSystems |
Abbexa |
|
-
100 rxns × 20 ul Systems
-
50 rxns × 20 ul Systems
|
- Shipped within 5-10 working days.
|
cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean |
C1634370 |
Biochain |
40 reactions |
EUR 621 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA Probe Diluent Solution |
AR0063 |
BosterBio |
5mL |
EUR 106 |
cDNA from Arteriosclerosis: Aorta |
C1236012Hd-4 |
Biochain |
40 reactions |
EUR 811 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from hypertension: Artery |
C1236013Hd-2 |
Biochain |
40 reactions |
EUR 668 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Arteriosclerosis: Artery |
C1236013Hd-4 |
Biochain |
40 reactions |
EUR 811 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from hypertension: Vein |
C1236020Hd-2 |
Biochain |
40 reactions |
EUR 668 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Colon |
C1236090Lup |
Biochain |
40 reactions |
EUR 668 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from hypertension: Heart |
C1236122Hd-2 |
Biochain |
40 reactions |
EUR 668 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Heart |
C1236122Lup |
Biochain |
40 reactions |
EUR 668 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from hypertension: Kidney |
C1236142Hd-2 |
Biochain |
40 reactions |
EUR 668 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Kidney |
C1236142Lup |
Biochain |
40 reactions |
EUR 668 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Liver |
C1236149Lup |
Biochain |
40 reactions |
EUR 668 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Asthma: Lung |
C1236152Ld-1 |
Biochain |
40 reactions |
EUR 811 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Bronchitis: Lung |
C1236152Ld-2 |
Biochain |
40 reactions |
EUR 811 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Emphysema: Lung |
C1236152Ld-3 |
Biochain |
40 reactions |
EUR 811 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Pneumonia: Lung |
C1236152Ld-4 |
Biochain |
40 reactions |
EUR 811 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Lung |
C1236152Lup |
Biochain |
40 reactions |
EUR 668 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Pancreas |
C1236188Lup |
Biochain |
40 reactions |
EUR 668 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Spleen |
C1236246Lup |
Biochain |
40 reactions |
EUR 668 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: stomach |
C1236248Lup |
Biochain |
40 reactions |
EUR 668 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
Tetro cDNA Synthesis Kit |
BIO-65042 |
Bioline |
30 Reactions |
Ask for price |
Tetro cDNA Synthesis Kit |
BIO-65043 |
Bioline |
100 Reactions |
Ask for price |
SensiFAST cDNA Synthesis Kit |
BIO-65053 |
Bioline |
50 Reactions |
Ask for price |
SensiFAST cDNA Synthesis Kit |
BIO-65053/S |
Bioline |
Sample |
Ask for price |
SensiFAST cDNA Synthesis Kit |
BIO-65054 |
Bioline |
250 Reactions |
Ask for price |
OneScriptPlus cDNA Synthesis Kit |
G235 |
ABM |
25 x 20 ul reactions |
EUR 97 |
OneScriptPlus cDNA Synthesis Kit |
G236 |
ABM |
100 x 20 ul reactions |
EUR 169 |
OneScriptPlus cDNA Synthesis SuperMix |
G453 |
ABM |
25 x 20 ul reactions |
EUR 97 |
OneScriptPlus cDNA Synthesis SuperMix |
G454 |
ABM |
100 x 20 ul reactions |
EUR 169 |
circRNA cDNA Synthesis Kit |
G627 |
ABM |
25 rxn (20 ul/rxn) |
EUR 309 |
Novo? Transcriptome cDNA Kit |
M1167-100 |
Biovision |
|
EUR 952 |
Novo? Transcriptome cDNA Kit |
M1167-25 |
Biovision |
|
EUR 441 |
Rnase12 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6296902 |
ABM |
1.0 ug DNA |
EUR 154 |
Rnase12 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6296903 |
ABM |
1.0 ug DNA |
EUR 154 |
Rnase12 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6296904 |
ABM |
1.0 ug DNA |
EUR 154 |
RNASE12 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1832202 |
ABM |
1.0 ug DNA |
EUR 154 |
RNASE12 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1832203 |
ABM |
1.0 ug DNA |
EUR 154 |
RNASE12 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1832204 |
ABM |
1.0 ug DNA |
EUR 154 |
Rnase12 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3570802 |
ABM |
1.0 ug DNA |
EUR 154 |
Rnase12 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3570803 |
ABM |
1.0 ug DNA |
EUR 154 |
Rnase12 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3570804 |
ABM |
1.0 ug DNA |
EUR 154 |
RNASE12 Protein Vector (Rat) (pPB-C-His) |
PV301630 |
ABM |
500 ng |
EUR 603 |
RNASE12 Protein Vector (Rat) (pPB-N-His) |
PV301631 |
ABM |
500 ng |
EUR 603 |
RNASE12 Protein Vector (Rat) (pPM-C-HA) |
PV301632 |
ABM |
500 ng |
EUR 603 |
RNASE12 Protein Vector (Rat) (pPM-C-His) |
PV301633 |
ABM |
500 ng |
EUR 603 |
RNASE12 Protein Vector (Human) (pPB-C-His) |
PV057233 |
ABM |
500 ng |
EUR 481 |
RNASE12 Protein Vector (Human) (pPB-N-His) |
PV057234 |
ABM |
500 ng |
EUR 481 |
RNASE12 Protein Vector (Human) (pPM-C-HA) |
PV057235 |
ABM |
500 ng |
EUR 481 |
RNASE12 Protein Vector (Human) (pPM-C-His) |
PV057236 |
ABM |
500 ng |
EUR 481 |
RNASE12 Protein Vector (Mouse) (pPB-C-His) |
PV224486 |
ABM |
500 ng |
EUR 603 |
RNASE12 Protein Vector (Mouse) (pPB-N-His) |
PV224487 |
ABM |
500 ng |
EUR 603 |
RNASE12 Protein Vector (Mouse) (pPM-C-HA) |
PV224488 |
ABM |
500 ng |
EUR 603 |
RNASE12 Protein Vector (Mouse) (pPM-C-His) |
PV224489 |
ABM |
500 ng |
EUR 603 |
Rnase12 3'UTR Luciferase Stable Cell Line |
TU117925 |
ABM |
1.0 ml |
Ask for price |
Rnase12 3'UTR GFP Stable Cell Line |
TU167925 |
ABM |
1.0 ml |
Ask for price |
We imagine that this overview offers all customers of single-cell transcriptome applied sciences with an understanding of the connection between the quantitative efficiency of varied strategies and their molecular options.
Leave a Comment