Extraction of high-quality tissue-specific RNA from London plane trees (Platanus acerifolia), permitting the construction of a female inflorescence cDNA library

The London airplane tree (Platanus acerifolia Willd.) has world significance as an city landscaping tree and is the topic of genetic-improvement applications for productive sterility, illness and/or insect resistance. Molecular evaluation methods are essential to such applications, however could also be impeded by particular difficulties encountered throughout nucleic acid isolation.

An in depth RNA isolation and purification protocol, primarily based on established cetyltrimethyl-ammonium bromide (CTAB) extraction methods mixed with extra purification steps utilizing butanol and the ionic detergent CTAB, which overcomes these issues within the woody species P. acerifolia, was carried out. Briefly, phenolic compounds are certain to soluble polyvinylpyrrolidone after which separated out by LiCl precipitation of the RNA. Subsequently, protein- and carbohydrate-contaminants are eliminated by chloroform partitioning adopted by LiCl-mediated precipitation.

The ensuing isolates of RNA had been discovered to be of adequate high quality for profitable use in reverse transcription PCR evaluation. Moreover, RNA isolates from feminine inflorescences had been used for the development of a cDNA library. This library was discovered to comprise a number of full-length cDNA clones of MADS-box genes, in line with the library being consultant of inflorescence expression profiles.

Transcriptome profiling of mouse samples utilizing nanopore sequencing of cDNA and RNA molecules.

Our imaginative and prescient of DNA transcription and splicing has modified dramatically with the introduction of short-read sequencing. These high-throughput sequencing applied sciences promised to unravel the complexity of any transcriptome. Typically gene expression ranges are well-captured utilizing these applied sciences, however there are nonetheless remaining caveats as a result of restricted learn size and the truth that RNA molecules needed to be reverse transcribed earlier than sequencing.

Oxford Nanopore Applied sciences has lately launched a transportable sequencer which provides the opportunity of sequencing lengthy reads and most significantly RNA molecules. Right here we generated a full mouse transcriptome from mind and liver utilizing the Oxford Nanopore machine. As a comparability, we sequenced RNA (RNA-Seq) and cDNA (cDNA-Seq) molecules utilizing each lengthy and quick reads applied sciences and examined the TeloPrime preparation package, devoted to the enrichment of full-length transcripts.

Utilizing spike-in knowledge, we confirmed that expression ranges are effectively captured by cDNA-Seq utilizing quick reads. Extra importantly, Oxford Nanopore RNA-Seq tends to be extra environment friendly, whereas cDNA-Seq seems to be extra biased. We additional present that the cDNA library preparation of the Nanopore protocol induces learn truncation for transcripts containing inside runs of T’s.

Extraction of high-quality tissue-specific RNA from London plane trees (Platanus acerifolia), permitting the construction of a female inflorescence cDNA library

This bias is marked for runs of at the very least 15 T’s, however is already detectable for runs of at the very least 9 T’s and due to this fact considerations greater than 20% of expressed transcripts in mouse mind and liver. Lastly, we define that bioinformatics challenges stay forward for quantifying on the transcript stage, particularly when reads are usually not full-length. Correct quantification of repeat-associated genes equivalent to processed pseudogenes additionally stays troublesome, and we present that present mapping protocols which map reads to the genome largely over-estimate their expression, on the expense of their mother or father gene.

Rolling Circle cDNA Synthesis Uncovers Round RNA Splice Variants.

Excessive-throughput RNA sequencing and novel bioinformatic pipelines have recognized 1000’s of round (circ)RNAs containing backsplice junction sequences. Nevertheless, circRNAs generated from a number of exons might comprise totally different combos of exons and/or introns arising from different splicing, whereas the backsplice junction sequence is similar. To have the ability to establish circRNA splice variants, we developed a way termed circRNA-Rolling Circle Amplification (circRNA-RCA).
This methodology detects full-length circRNA sequences by performing reverse transcription (RT) within the absence of RNase H exercise, adopted by polymerase chain response (PCR) amplification of full-length circRNAs utilizing a ahead primer spanning the backsplice junction sequence and a reverse primer precisely upstream of the ahead primer.
By sequencing the PCR merchandise, circRNA splice variants bearing the identical backsplice junctions, which had been in any other case solely predicted computationally, may very well be experimentally validated. The splice variants had been additional predicted to affiliate with totally different subsets of goal RNA-binding proteins and microRNAs, supporting the notion that totally different circRNA splice variants can have totally different organic impacts. In sum, the circRNA-RCA methodology permits the correct identification of full-length circRNA sequences, providing distinctive perception into their particular person operate.

Methods for Changing RNA to Amplifiable cDNA for Single-Cell RNA Sequencing Strategies.

This overview describes the options of molecular biology methods for single-cell RNA sequencing (scRNA-seq), together with strategies developed in our laboratory. Current scRNA-seq strategies require the conversion of first-strand cDNA to amplifiable cDNA adopted by whole-transcript amplification. There are three major methods for this conversion: poly-A tagging, template switching, and RNase H-DNA polymerase I-mediated second-strand cDNA synthesis for in vitro transcription.
We focus on the deserves and limitations of those methods and describe our Reverse Transcription with Random Displacement Amplification know-how that permits for direct first-strand cDNA amplification from RNA with out the necessity for conversion to an amplifiable cDNA.

RNASE12 Antibody

DF6217 200ul
EUR 304
Description: RNASE12 Antibody detects endogenous levels of total RNASE12.

RNASE12 Antibody

CSB-PA019792KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against RNASE12. Recognizes RNASE12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

RNASE12 Antibody

CSB-PA019792KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against RNASE12. Recognizes RNASE12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

RNASE12 siRNA

20-abx904594
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RNASE12 siRNA

20-abx931614
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RNASE12 siRNA

20-abx931615
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RNASE12 Antibody

ABD6217 100 ug
EUR 438

Ribonuclease A12 (RNASE12) Polyclonal Antibody (Human)

4-PAT642Hu01
  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RNASE12 (Glu21~Lys147)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ribonuclease A12 (RNASE12)

RNASE12 Rabbit pAb

A1072-100ul 100 ul
EUR 308

RNASE12 Rabbit pAb

A1072-200ul 200 ul
EUR 459

RNASE12 Rabbit pAb

A1072-20ul 20 ul
EUR 183

RNASE12 Rabbit pAb

A1072-50ul 50 ul
EUR 223

RNASE12 Rabbit pAb

A14607-100ul 100 ul
EUR 308

RNASE12 Rabbit pAb

A14607-200ul 200 ul
EUR 459

RNASE12 Rabbit pAb

A14607-20ul 20 ul
EUR 183

RNASE12 Rabbit pAb

A14607-50ul 50 ul
EUR 223

RNASE12 Rabbit pAb

A14608-100ul 100 ul
EUR 308

RNASE12 Rabbit pAb

A14608-200ul 200 ul
EUR 459

RNASE12 Rabbit pAb

A14608-20ul 20 ul
EUR 183

RNASE12 Rabbit pAb

A14608-50ul 50 ul
EUR 223

RNASE12 Blocking Peptide

DF6217-BP 1mg
EUR 195

RNASE12 Conjugated Antibody

C38175 100ul
EUR 397

RNASE12 cloning plasmid

CSB-CL708031HU-10ug 10ug
EUR 234
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 444
  • Sequence: atgataataatggtgataattttcttggtgcttctgttctgggaaaatgaggtgaatgatgaagcagtgatgtcaactttagaacacttgcatgtggactaccctcagaatgacgttcccgttcctgcaaggtactgcaaccacatgatcatacaaagagttatcagggaacctga
  • Show more
Description: A cloning plasmid for the RNASE12 gene.

Anti-RNASE12 antibody

STJ25363 100 µl
EUR 277

Anti-RNASE12 antibody

STJ116817 100 µl
EUR 277

Anti-RNASE12 antibody

STJ116818 100 µl
EUR 277

Ribonuclease A12 (RNASE12) Polyclonal Antibody (Human), APC

4-PAT642Hu01-APC
  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RNASE12 (Glu21~Lys147)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ribonuclease A12 (RNASE12). This antibody is labeled with APC.

Ribonuclease A12 (RNASE12) Polyclonal Antibody (Human), Biotinylated

4-PAT642Hu01-Biotin
  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RNASE12 (Glu21~Lys147)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ribonuclease A12 (RNASE12). This antibody is labeled with Biotin.

Ribonuclease A12 (RNASE12) Polyclonal Antibody (Human), Cy3

4-PAT642Hu01-Cy3
  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RNASE12 (Glu21~Lys147)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ribonuclease A12 (RNASE12). This antibody is labeled with Cy3.

Ribonuclease A12 (RNASE12) Polyclonal Antibody (Human), FITC

4-PAT642Hu01-FITC
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RNASE12 (Glu21~Lys147)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ribonuclease A12 (RNASE12). This antibody is labeled with FITC.

Ribonuclease A12 (RNASE12) Polyclonal Antibody (Human), HRP

4-PAT642Hu01-HRP
  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RNASE12 (Glu21~Lys147)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ribonuclease A12 (RNASE12). This antibody is labeled with HRP.

Ribonuclease A12 (RNASE12) Polyclonal Antibody (Human), PE

4-PAT642Hu01-PE
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RNASE12 (Glu21~Lys147)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ribonuclease A12 (RNASE12). This antibody is labeled with PE.

Ribonuclease A12 (RNASE12) Antibody

20-abx101918
  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Ribonuclease A12 (RNASE12) Antibody

abx117029-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Ribonuclease A12 (RNASE12) Antibody

abx146450-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Rat RNASE12 shRNA Plasmid

20-abx990586
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RNASE12 shRNA Plasmid

20-abx984097
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RNASE12 shRNA Plasmid

20-abx968360
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Ribonuclease A12 (RNASE12) Antibody

20-abx000995
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

RNASE12 Recombinant Protein (Human)

RP042925 100 ug Ask for price

RNASE12 Recombinant Protein (Mouse)

RP168362 100 ug Ask for price

RNASE12 Recombinant Protein (Rat)

RP226220 100 ug Ask for price

Ribonuclease A12 (RNASE12) Polyclonal Antibody (Human), APC-Cy7

4-PAT642Hu01-APC-Cy7
  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RNASE12 (Glu21~Lys147)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ribonuclease A12 (RNASE12). This antibody is labeled with APC-Cy7.

Human Ribonuclease A12 (RNASE12) Protein

20-abx068911
  • EUR 690.00
  • EUR 286.00
  • EUR 2110.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ribonuclease A12 (RNASE12) Antibody (Biotin)

20-abx271884
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rnase12 ORF Vector (Rat) (pORF)

ORF075408 1.0 ug DNA
EUR 506

RNASE12 ORF Vector (Human) (pORF)

ORF014309 1.0 ug DNA
EUR 354

Rnase12 ORF Vector (Mouse) (pORF)

ORF056122 1.0 ug DNA
EUR 506

cDNA Synthesis SuperMix

20-abx09801420ulSystems
  • EUR 565.00
  • EUR 481.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

Evo? cDNA Kit

M1164-100
EUR 294

Evo? cDNA Kit

M1164-25
EUR 234

Novo? cDNA Kit

M1165-100
EUR 354

Novo? cDNA Kit

M1165-25
EUR 267

Evo? cDNA Supermix

M1168-100
EUR 381

Evo? cDNA Supermix

M1168-25
EUR 267

Novo? cDNA Supermix

M1169-100
EUR 441

Novo? cDNA Supermix

M1169-25
EUR 289

Rnase12 sgRNA CRISPR Lentivector set (Rat)

K6296901 3 x 1.0 ug
EUR 339

RNASE12 sgRNA CRISPR Lentivector set (Human)

K1832201 3 x 1.0 ug
EUR 339

Rnase12 sgRNA CRISPR Lentivector set (Mouse)

K3570801 3 x 1.0 ug
EUR 339

Human Ribonuclease A12(RNASE12)ELISA Kit

QY-E03175 96T
EUR 361

cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis

C1634310 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Corn

C1634330 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Orange

C1634340 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Potato

C1634350 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Rice

C1634360 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Wheat

C1634390 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)

20-abx09801620ulSystems
  • EUR 620.00
  • EUR 523.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)

20-abx09802120ulSystems
  • EUR 871.00
  • EUR 662.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean

C1634370 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA Probe Diluent Solution

AR0063 5mL
EUR 106

cDNA from Arteriosclerosis: Aorta

C1236012Hd-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Artery

C1236013Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Arteriosclerosis: Artery

C1236013Hd-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Vein

C1236020Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Colon

C1236090Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart

C1236122Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Heart

C1236122Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Kidney

C1236142Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Kidney

C1236142Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Liver

C1236149Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Asthma: Lung

C1236152Ld-1 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Bronchitis: Lung

C1236152Ld-2 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Emphysema: Lung

C1236152Ld-3 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Pneumonia: Lung

C1236152Ld-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Lung

C1236152Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Pancreas

C1236188Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Spleen

C1236246Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: stomach

C1236248Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Tetro cDNA Synthesis Kit

BIO-65042 30 Reactions Ask for price

Tetro cDNA Synthesis Kit

BIO-65043 100 Reactions Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65053 50 Reactions Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65053/S Sample Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65054 250 Reactions Ask for price

OneScriptPlus cDNA Synthesis Kit

G235 25 x 20 ul reactions
EUR 97

OneScriptPlus cDNA Synthesis Kit

G236 100 x 20 ul reactions
EUR 169

OneScriptPlus cDNA Synthesis SuperMix

G453 25 x 20 ul reactions
EUR 97

OneScriptPlus cDNA Synthesis SuperMix

G454 100 x 20 ul reactions
EUR 169

circRNA cDNA Synthesis Kit

G627 25 rxn (20 ul/rxn)
EUR 309

Human eNOS cDNA probe

eNOS51-D-2 2 ug
EUR 445

Novo? Transcriptome cDNA Kit

M1167-100
EUR 952

Novo? Transcriptome cDNA Kit

M1167-25
EUR 441

Plant Tissue cDNA: Arabidopsis

PC34-310 10 rxn
EUR 415

Rnase12 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6296902 1.0 ug DNA
EUR 154

Rnase12 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6296903 1.0 ug DNA
EUR 154

Rnase12 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6296904 1.0 ug DNA
EUR 154

RNASE12 sgRNA CRISPR Lentivector (Human) (Target 1)

K1832202 1.0 ug DNA
EUR 154

RNASE12 sgRNA CRISPR Lentivector (Human) (Target 2)

K1832203 1.0 ug DNA
EUR 154

RNASE12 sgRNA CRISPR Lentivector (Human) (Target 3)

K1832204 1.0 ug DNA
EUR 154

Rnase12 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3570802 1.0 ug DNA
EUR 154

Rnase12 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3570803 1.0 ug DNA
EUR 154

Rnase12 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3570804 1.0 ug DNA
EUR 154

RNASE12 Protein Vector (Rat) (pPB-C-His)

PV301630 500 ng
EUR 603

RNASE12 Protein Vector (Rat) (pPB-N-His)

PV301631 500 ng
EUR 603

RNASE12 Protein Vector (Rat) (pPM-C-HA)

PV301632 500 ng
EUR 603

RNASE12 Protein Vector (Rat) (pPM-C-His)

PV301633 500 ng
EUR 603

RNASE12 Protein Vector (Human) (pPB-C-His)

PV057233 500 ng
EUR 481

RNASE12 Protein Vector (Human) (pPB-N-His)

PV057234 500 ng
EUR 481

RNASE12 Protein Vector (Human) (pPM-C-HA)

PV057235 500 ng
EUR 481

RNASE12 Protein Vector (Human) (pPM-C-His)

PV057236 500 ng
EUR 481

RNASE12 Protein Vector (Mouse) (pPB-C-His)

PV224486 500 ng
EUR 603

RNASE12 Protein Vector (Mouse) (pPB-N-His)

PV224487 500 ng
EUR 603

RNASE12 Protein Vector (Mouse) (pPM-C-HA)

PV224488 500 ng
EUR 603

RNASE12 Protein Vector (Mouse) (pPM-C-His)

PV224489 500 ng
EUR 603

Rnase12 3'UTR Luciferase Stable Cell Line

TU117925 1.0 ml Ask for price

Rnase12 3'UTR GFP Stable Cell Line

TU167925 1.0 ml Ask for price
We imagine that this overview offers all customers of single-cell transcriptome applied sciences with an understanding of the connection between the quantitative efficiency of varied strategies and their molecular options.

 

Leave a Comment