Comparative evaluation of cDNA library construction approaches for RNA-Seq analysis from low RNA-content human specimens.

Comparative evaluation of cDNA library construction approaches for RNA-Seq analysis from low RNA-content human specimens.

With the emergence of RNA sequencing applied sciences, metatranscriptomic research are quickly gaining consideration as they concurrently present perception into gene expression profiles and subsequently illness affiliation pathways of microbial pathogens and their hosts. This strategy, subsequently, holds promise for applicability in infectious illness diagnostics.

A problem of this strategy within the scientific setting is the low quantity and high quality of RNA, particularly microbial RNA in most clinically-infected specimens. Right here, we in contrast two commercially accessible stranded cDNA library preparation kits, the NuGEN Ovation SoLo RNA-Seq System and the Illumina TruSeq Stranded Complete RNA, utilizing RNA extracted from synovial and sonicate fluids from a topic with periprosthetic joint an infection. The Ovation SoLo RNA-Seq System supplied extra helpful transcriptomic information for the infecting bacterium, whereas the TruSeq Stranded Complete RNA equipment supplied extra helpful human transcriptomic information.

PacBio full-length cDNA sequencing built-in with RNA-seq reads drastically improves the invention of splicing transcripts in rice.

In eukaryotes, various splicing (AS) vastly expands the variety of transcripts. Nevertheless, it’s difficult to precisely decide full-length splicing isoforms. Just lately, extra research have taken benefit of Pacific Bioscience (PacBio) long-read sequencing to establish full-length transcripts. Nonetheless, the excessive error fee of PacBio reads significantly offsets some great benefits of lengthy reads, particularly for precisely figuring out splicing junctions. To finest capitalize on the options of lengthy reads, we used Illumina RNA-seq reads to enhance PacBio round consensus sequence (CCS) high quality and to validate splicing patterns within the rice transcriptome.

We evaluated the influence of CCS accuracy on the quantity and the validation fee of splicing isoforms, and built-in a complete pipeline of splicing transcripts evaluation by Iso-Seq and RNA-seq (STAIR) to establish the full-length multi-exon isoforms in rice seedling transcriptome (Oryza sativa L. ssp. japonica). STAIR found 11 733 full-length multi-exon isoforms, 6599 greater than the SMRT Portal RS_IsoSeq pipeline did.

Of those splicing isoforms recognized, 4453 (37.9%) have been missed in assembled transcripts from RNA-seq reads, and 5204 (44.4%), together with 268 multi-exon lengthy non-coding RNAs (lncRNAs), weren’t reported within the MSU_osa1r7 annotation. Some randomly chosen unreported splicing junctions have been verified by polymerase chain response (PCR) amplification.

Comparative evaluation of cDNA library construction approaches for RNA-Seq analysis from low RNA-content human specimens.

As well as, we investigated various polyadenylation (APA) occasions in transcripts and recognized 829 main polyadenylation [poly(A)] web site clusters (PACs). The evaluation of splicing isoforms and APA occasions will facilitate the annotation of the rice genome and research on the expression and polyadenylation of AS genes in numerous developmental phases or progress situations of rice.

An RNA Binding Peptide Consisting of 4 Varieties of Amino Acid by in Vitro Choice Utilizing cDNA Show.

RNA-protein interactions have a central function within the residing world. On this article, we examined whether or not primitive peptides (30 residues) consisting of 4 kinds of amino acid (Gly, Ala, Asp, and Val) might work together with tRNA as a mannequin of primitive RNAs within the RNA world. By in vitro choice of binding peptides utilizing the cDNA show methodology, a attribute peptide was chosen from a random peptide library and assayed by electrophoretic mobility shift and pull-down assays. Curiously, the chosen peptide certain to a single-stranded area together with a loop construction of an RNA molecule with some sequence specificity.

Comparability of varied RNA extraction strategies, cDNA preparation and isolation of calmodulin gene from a extremely melanized isolate of apple leaf blotch fungus Marssonina coronaria.

Marssonina coronaria causes apple blotch illness leading to extreme untimely defoliation, and is distributed in lots of main apple-growing areas on the planet. Efficient, dependable and high-quality RNA extraction is an indispensable process in any molecular biology examine. No methodology presently exists for RNA extraction from M. coronaria that produces a excessive amount of melanin-free RNA.
Subsequently, we evaluated eight RNA extraction strategies together with handbook and industrial kits, to yield a ample amount of high-quality and melanin-free RNA. Guide strategies used right here resulted in low high quality and black coloured RNA pellets exhibiting the presence of melanin, regardless of all of the modifications employed to authentic procedures. Nevertheless, these strategies when coupled with clear up resulted in melanin-free RNA.
Alternatively, all industrial kits used have been in a position to yield high-quality melanin-free RNA having variable yields. TRIzol™ Reagent + RNA Clear & Concentrator™-5 and Ambion-PureLink® RNA Mini Package have been discovered to be the perfect strategies because the RNA extracted with these strategies from 15 day previous fungal tradition grown on strong medium have been freed from melanin with good yield. RNA extracted by this improved methodology was utilized for RT-PCR, subsequent PCR amplification, and isolation of calmodulin gene sequences from M. coronaria and contaminated apple leaf items.

Canine Collagen Type I Alpha 2 (COL1a2) ELISA Kit

DLR-COL1a2-c-96T 96T
EUR 688
  • Should the Canine Collagen Type I Alpha 2 (COL1a2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine Collagen Type I Alpha 2 (COL1a2) in samples from serum, plasma or other biological fluids.

Human Collagen Type I Alpha 2 (COL1a2) ELISA Kit

DLR-COL1a2-Hu-48T 48T
EUR 479
  • Should the Human Collagen Type I Alpha 2 (COL1a2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Collagen Type I Alpha 2 (COL1a2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Collagen Type I Alpha 2 (COL1a2) ELISA Kit

DLR-COL1a2-Hu-96T 96T
EUR 621
  • Should the Human Collagen Type I Alpha 2 (COL1a2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Collagen Type I Alpha 2 (COL1a2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Collagen Type I Alpha 2 (COL1a2) ELISA Kit

DLR-COL1a2-Mu-48T 48T
EUR 489
  • Should the Mouse Collagen Type I Alpha 2 (COL1a2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Collagen Type I Alpha 2 (COL1a2) in samples from serum, plasma or other biological fluids.

Mouse Collagen Type I Alpha 2 (COL1a2) ELISA Kit

DLR-COL1a2-Mu-96T 96T
EUR 635
  • Should the Mouse Collagen Type I Alpha 2 (COL1a2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Collagen Type I Alpha 2 (COL1a2) in samples from serum, plasma or other biological fluids.

Rat Collagen Type I Alpha 2 (COL1a2) ELISA Kit

DLR-COL1a2-Ra-48T 48T
EUR 508
  • Should the Rat Collagen Type I Alpha 2 (COL1a2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Collagen Type I Alpha 2 (COL1a2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Collagen Type I Alpha 2 (COL1a2) ELISA Kit

DLR-COL1a2-Ra-96T 96T
EUR 661
  • Should the Rat Collagen Type I Alpha 2 (COL1a2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Collagen Type I Alpha 2 (COL1a2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rabbit Collagen Type I Alpha 2 (COL1a2) ELISA Kit

DLR-COL1a2-Rb-48T 48T
EUR 508
  • Should the Rabbit Collagen Type I Alpha 2 (COL1a2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit Collagen Type I Alpha 2 (COL1a2) in samples from serum, plasma or other biological fluids.

Rabbit Collagen Type I Alpha 2 (COL1a2) ELISA Kit

DLR-COL1a2-Rb-96T 96T
EUR 661
  • Should the Rabbit Collagen Type I Alpha 2 (COL1a2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit Collagen Type I Alpha 2 (COL1a2) in samples from serum, plasma or other biological fluids.

Bovine Collagen Type I Alpha 2 (COL1a2) ELISA Kit

RDR-COL1a2-b-48Tests 48 Tests
EUR 580

Bovine Collagen Type I Alpha 2 (COL1a2) ELISA Kit

RDR-COL1a2-b-96Tests 96 Tests
EUR 807

Canine Collagen Type I Alpha 2 (COL1a2) ELISA Kit

RDR-COL1a2-c-48Tests 48 Tests
EUR 557

Canine Collagen Type I Alpha 2 (COL1a2) ELISA Kit

RDR-COL1a2-c-96Tests 96 Tests
EUR 774

Human Collagen Type I Alpha 2 (COL1a2) ELISA Kit

RDR-COL1a2-Hu-48Tests 48 Tests
EUR 500

Human Collagen Type I Alpha 2 (COL1a2) ELISA Kit

RDR-COL1a2-Hu-96Tests 96 Tests
EUR 692

Mouse Collagen Type I Alpha 2 (COL1a2) ELISA Kit

RDR-COL1a2-Mu-48Tests 48 Tests
EUR 511

Mouse Collagen Type I Alpha 2 (COL1a2) ELISA Kit

RDR-COL1a2-Mu-96Tests 96 Tests
EUR 709

Rat Collagen Type I Alpha 2 (COL1a2) ELISA Kit

RDR-COL1a2-Ra-48Tests 48 Tests
EUR 534

Rat Collagen Type I Alpha 2 (COL1a2) ELISA Kit

RDR-COL1a2-Ra-96Tests 96 Tests
EUR 742

Rabbit Collagen Type I Alpha 2 (COL1a2) ELISA Kit

RDR-COL1a2-Rb-48Tests 48 Tests
EUR 534

Rabbit Collagen Type I Alpha 2 (COL1a2) ELISA Kit

RDR-COL1a2-Rb-96Tests 96 Tests
EUR 742

Bovine Collagen Type I Alpha 2 (COL1a2) ELISA Kit

RD-COL1a2-b-48Tests 48 Tests
EUR 555

Bovine Collagen Type I Alpha 2 (COL1a2) ELISA Kit

RD-COL1a2-b-96Tests 96 Tests
EUR 771

Canine Collagen Type I Alpha 2 (COL1a2) ELISA Kit

RD-COL1a2-c-48Tests 48 Tests
EUR 533

Canine Collagen Type I Alpha 2 (COL1a2) ELISA Kit

RD-COL1a2-c-96Tests 96 Tests
EUR 740

Human Collagen Type I Alpha 2 (COL1a2) ELISA Kit

RD-COL1a2-Hu-48Tests 48 Tests
EUR 478

Human Collagen Type I Alpha 2 (COL1a2) ELISA Kit

RD-COL1a2-Hu-96Tests 96 Tests
EUR 662

Mouse Collagen Type I Alpha 2 (COL1a2) ELISA Kit

RD-COL1a2-Mu-48Tests 48 Tests
EUR 489

Mouse Collagen Type I Alpha 2 (COL1a2) ELISA Kit

RD-COL1a2-Mu-96Tests 96 Tests
EUR 677

Rat Collagen Type I Alpha 2 (COL1a2) ELISA Kit

RD-COL1a2-Ra-48Tests 48 Tests
EUR 511

Rat Collagen Type I Alpha 2 (COL1a2) ELISA Kit

RD-COL1a2-Ra-96Tests 96 Tests
EUR 709

Rabbit Collagen Type I Alpha 2 (COL1a2) ELISA Kit

RD-COL1a2-Rb-48Tests 48 Tests
EUR 511

Rabbit Collagen Type I Alpha 2 (COL1a2) ELISA Kit

RD-COL1a2-Rb-96Tests 96 Tests
EUR 709

COL1a2/ Rat COL1a2 ELISA Kit

ELA-E2570r 96 Tests
EUR 886

Col1a2/ Rat Col1a2 ELISA Kit

ELI-33673r 96 Tests
EUR 886

COL1A2 antibody

70R-16497 50 ul
EUR 435
Description: Rabbit polyclonal COL1A2 antibody

COL1A2 antibody

70R-31222 100 ug
EUR 327
Description: Rabbit polyclonal COL1A2 antibody

COL1A2 Antibody

35634-100ul 100ul
EUR 252

COL1A2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against COL1A2. Recognizes COL1A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

COL1A2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against COL1A2. Recognizes COL1A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

COL1A2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against COL1A2. Recognizes COL1A2 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

COL1A2 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against COL1A2. Recognizes COL1A2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

COL1A2 Antibody

CSB-PA571805-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against COL1A2. Recognizes COL1A2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

COL1A2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against COL1A2. Recognizes COL1A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:100-1:300

COL1A2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against COL1A2. Recognizes COL1A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

COL1A2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against COL1A2. Recognizes COL1A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000

COL1A2 antibody

70R-49569 100 ul
EUR 244
Description: Purified Polyclonal COL1A2 antibody

COL1A2 antibody

70R-49570 100 ul
EUR 454
Description: Purified Polyclonal COL1A2 antibody


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

COL1A2 Polyclonal Antibody

40771-100ul 100ul
EUR 252

COL1A2 Polyclonal Antibody

40771-50ul 50ul
EUR 187

COL1A2/COL1A1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against COL1A2/COL1A1. Recognizes COL1A2/COL1A1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000

Anti-COL1A2 Antibody

A00624-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for COL1A2 Antibody (COL1A2) detection.tested for WB in Human, Mouse, Rat.

COL1A2 Blocking Peptide

  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

COL1A2 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

COL1A2 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

COL1A2 Conjugated Antibody

C35634 100ul
EUR 397

COL1A2 / COL1A1 Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

COL1A2 cloning plasmid

CSB-CL005728HU-10ug 10ug
EUR 1612
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 4101
  • Sequence: atgctcagctttgtggatacgcggactttgttgctgcttgcagtaaccttatgcctagcaacatgccaatctttacaagaggaaactgtaagaaagggcccagccggagatagaggaccacgtggagaaaggggtccaccaggccccccaggcagagatggtgaagatggtccca
  • Show more
Description: A cloning plasmid for the COL1A2 gene.

COL1A2 Polyclonal Antibody

ABP51021-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human COL1A2 at AA range: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of COL1A2 from Human, Mouse, Rat. This COL1A2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human COL1A2 at AA range: 1-80

COL1A2 Polyclonal Antibody

ABP51021-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human COL1A2 at AA range: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of COL1A2 from Human, Mouse, Rat. This COL1A2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human COL1A2 at AA range: 1-80

COL1A2 Polyclonal Antibody

ABP51021-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human COL1A2 at AA range: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of COL1A2 from Human, Mouse, Rat. This COL1A2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human COL1A2 at AA range: 1-80

COL1A2 Polyclonal Antibody

ABP51022-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human COL1A2 at AA range: 440-520
  • Applications tips:
Description: A polyclonal antibody for detection of COL1A2 from Human. This COL1A2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human COL1A2 at AA range: 440-520

COL1A2 Polyclonal Antibody

ABP51022-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human COL1A2 at AA range: 440-520
  • Applications tips:
Description: A polyclonal antibody for detection of COL1A2 from Human. This COL1A2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human COL1A2 at AA range: 440-520

COL1A2 Polyclonal Antibody

ABP51022-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human COL1A2 at AA range: 440-520
  • Applications tips:
Description: A polyclonal antibody for detection of COL1A2 from Human. This COL1A2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human COL1A2 at AA range: 440-520

COL1A2 Rabbit pAb

A5786-100ul 100 ul
EUR 308

COL1A2 Rabbit pAb

A5786-200ul 200 ul
EUR 459

COL1A2 Rabbit pAb

A5786-20ul 20 ul
EUR 183

COL1A2 Rabbit pAb

A5786-50ul 50 ul
EUR 223

COL1A2 Rabbit pAb

A16699-100ul 100 ul
EUR 308

COL1A2 Rabbit pAb

A16699-200ul 200 ul
EUR 459

COL1A2 Rabbit pAb

A16699-20ul 20 ul
EUR 183

COL1A2 Rabbit pAb

A16699-50ul 50 ul
EUR 223

COL1A2 Polyclonal Antibody

ES2020-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against COL1A2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

COL1A2 Polyclonal Antibody

ES2020-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against COL1A2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

COL1A2 Polyclonal Antibody

ES2021-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against COL1A2 from Human. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

COL1A2 Polyclonal Antibody

ES2021-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against COL1A2 from Human. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

Anti-COL1A2 (7E11)

YF-MA12496 100 ug
EUR 363
Description: Mouse monoclonal to COL1A2

Anti-COL1A2 antibody

STJ28351 100 µl
EUR 277
Description: This gene encodes the pro-alpha2 chain of type I collagen whose triple helix comprises two alpha1 chains and one alpha2 chain. Type I is a fibril-forming collagen found in most connective tissues and is abundant in bone, cornea, dermis and tendon. Mutations in this gene are associated with osteogenesis imperfecta types I-IV, Ehlers-Danlos syndrome type VIIB, recessive Ehlers-Danlos syndrome Classical type, idiopathic osteoporosis, and atypical Marfan syndrome. Symptoms associated with mutations in this gene, however, tend to be less severe than mutations in the gene for the alpha1 chain of type I collagen (COL1A1) reflecting the different role of alpha2 chains in matrix integrity. Three transcripts, resulting from the use of alternate polyadenylation signals, have been identified for this gene.

Anti-COL1A2 antibody

STJ119121 100 µl
EUR 277

Anti-COL1A2 antibody

STJ92383 200 µl
EUR 197
Description: COL1A2 is a protein encoded by the COL1A2 gene which is approximately 129,3 kDa. COL1A2 is secreted into the extracellular space. It is involved in collagen chain trimerization, the integrin pathway, ERK signalling and focal adhesion. It is a pro-alpha-2 chain of type I collagen whose triple helix comprises two alpha-1 chains and one alpha-2 chain. COL1A2 is expressed in tendons, ligaments and bones. Mutations in the COL1A2 gene may result in Ehlers-Danlos syndrome and osteogenesis imperfecta. STJ92383 was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen. This polyclonal antibody detects endogenous levels of COL1A2 protein.

Anti-COL1A2 antibody

STJ92384 200 µl
EUR 197
Description: Rabbit polyclonal to COL1A2.

Recombinant Collagen Type I Alpha 2 (COL1a2)

  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O46392
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 60.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Dog Collagen Type I Alpha 2 expressed in: E.coli

Recombinant Collagen Type I Alpha 2 (COL1a2)

  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P08123
  • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.4kDa
  • Isoelectric Point: 5.4
Description: Recombinant Human Collagen Type I Alpha 2 expressed in: E.coli

Recombinant Collagen Type I Alpha 2 (COL1a2)

  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q01149
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.0kDa
  • Isoelectric Point: 6.2
Description: Recombinant Mouse Collagen Type I Alpha 2 expressed in: E.coli

cDNA Synthesis SuperMix

  • EUR 565.00
  • EUR 481.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

Evo? cDNA Kit

EUR 294

Evo? cDNA Kit

EUR 234

Novo? cDNA Kit

EUR 354

Novo? cDNA Kit

EUR 267

Evo? cDNA Supermix

EUR 381

Evo? cDNA Supermix

EUR 267

Novo? cDNA Supermix

EUR 441

Novo? cDNA Supermix

EUR 289

Cleaved-COL1A2 (G1102) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Cleaved-COL1A2 (G1102). Recognizes Cleaved-COL1A2 (G1102) from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000
These strategies are extra time efficient than conventional strategies and take solely an hour to finish. To our information, that is the primary report on the strategy of isolation of high-quality RNA for cDNA synthesis in addition to isolation of the calmodulin gene sequence from this fungus.

Leave a Reply

Your email address will not be published.

Related Post

C3 complement inhibition prevents antibody-mediated rejection and prolongs renal allograft survival in sensitized non-human primates

C3 complement inhibition prevents antibody-mediated rejection and prolongs renal allograft survival in sensitized non-human primatesC3 complement inhibition prevents antibody-mediated rejection and prolongs renal allograft survival in sensitized non-human primates

Sensitized kidney transplant recipients expertise excessive charges of antibody-mediated rejection as a result of presence of donor-specific antibodies and immunologic reminiscence. Right here we present that transient peri-transplant therapy with

DNA Replication-Transcription Conflicts Do Not Significantly Contribute to Spontaneous Mutations Due to Replication Errors in Escherichia coli

DNA Replication-Transcription Conflicts Do Not Significantly Contribute to Spontaneous Mutations Due to Replication Errors in Escherichia coliDNA Replication-Transcription Conflicts Do Not Significantly Contribute to Spontaneous Mutations Due to Replication Errors in Escherichia coli

Encounters between DNA replication and transcription could cause genomic disruption, significantly when the 2 meet head-on. Whether or not these conflicts produce level mutations is debated. This paper presents detailed