Comparative evaluation of cDNA library construction approaches for RNA-Seq analysis from low RNA-content human specimens.

With the emergence of RNA sequencing applied sciences, metatranscriptomic research are quickly gaining consideration as they concurrently present perception into gene expression profiles and subsequently illness affiliation pathways of microbial pathogens and their hosts. This strategy, subsequently, holds promise for applicability in infectious illness diagnostics.

A problem of this strategy within the scientific setting is the low quantity and high quality of RNA, particularly microbial RNA in most clinically-infected specimens. Right here, we in contrast two commercially accessible stranded cDNA library preparation kits, the NuGEN Ovation SoLo RNA-Seq System and the Illumina TruSeq Stranded Complete RNA, utilizing RNA extracted from synovial and sonicate fluids from a topic with periprosthetic joint an infection. The Ovation SoLo RNA-Seq System supplied extra helpful transcriptomic information for the infecting bacterium, whereas the TruSeq Stranded Complete RNA equipment supplied extra helpful human transcriptomic information.

PacBio full-length cDNA sequencing built-in with RNA-seq reads drastically improves the invention of splicing transcripts in rice.

In eukaryotes, various splicing (AS) vastly expands the variety of transcripts. Nevertheless, it’s difficult to precisely decide full-length splicing isoforms. Just lately, extra research have taken benefit of Pacific Bioscience (PacBio) long-read sequencing to establish full-length transcripts. Nonetheless, the excessive error fee of PacBio reads significantly offsets some great benefits of lengthy reads, particularly for precisely figuring out splicing junctions. To finest capitalize on the options of lengthy reads, we used Illumina RNA-seq reads to enhance PacBio round consensus sequence (CCS) high quality and to validate splicing patterns within the rice transcriptome.

We evaluated the influence of CCS accuracy on the quantity and the validation fee of splicing isoforms, and built-in a complete pipeline of splicing transcripts evaluation by Iso-Seq and RNA-seq (STAIR) to establish the full-length multi-exon isoforms in rice seedling transcriptome (Oryza sativa L. ssp. japonica). STAIR found 11 733 full-length multi-exon isoforms, 6599 greater than the SMRT Portal RS_IsoSeq pipeline did.

Of those splicing isoforms recognized, 4453 (37.9%) have been missed in assembled transcripts from RNA-seq reads, and 5204 (44.4%), together with 268 multi-exon lengthy non-coding RNAs (lncRNAs), weren’t reported within the MSU_osa1r7 annotation. Some randomly chosen unreported splicing junctions have been verified by polymerase chain response (PCR) amplification.

Comparative evaluation of cDNA library construction approaches for RNA-Seq analysis from low RNA-content human specimens.

As well as, we investigated various polyadenylation (APA) occasions in transcripts and recognized 829 main polyadenylation [poly(A)] web site clusters (PACs). The evaluation of splicing isoforms and APA occasions will facilitate the annotation of the rice genome and research on the expression and polyadenylation of AS genes in numerous developmental phases or progress situations of rice.

An RNA Binding Peptide Consisting of 4 Varieties of Amino Acid by in Vitro Choice Utilizing cDNA Show.

RNA-protein interactions have a central function within the residing world. On this article, we examined whether or not primitive peptides (30 residues) consisting of 4 kinds of amino acid (Gly, Ala, Asp, and Val) might work together with tRNA as a mannequin of primitive RNAs within the RNA world. By in vitro choice of binding peptides utilizing the cDNA show methodology, a attribute peptide was chosen from a random peptide library and assayed by electrophoretic mobility shift and pull-down assays. Curiously, the chosen peptide certain to a single-stranded area together with a loop construction of an RNA molecule with some sequence specificity.

Comparability of varied RNA extraction strategies, cDNA preparation and isolation of calmodulin gene from a extremely melanized isolate of apple leaf blotch fungus Marssonina coronaria.

Marssonina coronaria causes apple blotch illness leading to extreme untimely defoliation, and is distributed in lots of main apple-growing areas on the planet. Efficient, dependable and high-quality RNA extraction is an indispensable process in any molecular biology examine. No methodology presently exists for RNA extraction from M. coronaria that produces a excessive amount of melanin-free RNA.
Subsequently, we evaluated eight RNA extraction strategies together with handbook and industrial kits, to yield a ample amount of high-quality and melanin-free RNA. Guide strategies used right here resulted in low high quality and black coloured RNA pellets exhibiting the presence of melanin, regardless of all of the modifications employed to authentic procedures. Nevertheless, these strategies when coupled with clear up resulted in melanin-free RNA.
Alternatively, all industrial kits used have been in a position to yield high-quality melanin-free RNA having variable yields. TRIzol™ Reagent + RNA Clear & Concentrator™-5 and Ambion-PureLink® RNA Mini Package have been discovered to be the perfect strategies because the RNA extracted with these strategies from 15 day previous fungal tradition grown on strong medium have been freed from melanin with good yield. RNA extracted by this improved methodology was utilized for RT-PCR, subsequent PCR amplification, and isolation of calmodulin gene sequences from M. coronaria and contaminated apple leaf items.

Canine Collagen Type I Alpha 2 (COL1a2) ELISA Kit
DLR-COL1a2-c-96T 96T
EUR 688
  • Should the Canine Collagen Type I Alpha 2 (COL1a2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine Collagen Type I Alpha 2 (COL1a2) in samples from serum, plasma or other biological fluids.

Human Collagen Type I Alpha 2 (COL1a2) ELISA Kit
DLR-COL1a2-Hu-48T 48T
EUR 479
  • Should the Human Collagen Type I Alpha 2 (COL1a2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Collagen Type I Alpha 2 (COL1a2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Collagen Type I Alpha 2 (COL1a2) ELISA Kit
DLR-COL1a2-Hu-96T 96T
EUR 621
  • Should the Human Collagen Type I Alpha 2 (COL1a2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Collagen Type I Alpha 2 (COL1a2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Collagen Type I Alpha 2 (COL1a2) ELISA Kit
DLR-COL1a2-Mu-48T 48T
EUR 489
  • Should the Mouse Collagen Type I Alpha 2 (COL1a2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Collagen Type I Alpha 2 (COL1a2) in samples from serum, plasma or other biological fluids.

Mouse Collagen Type I Alpha 2 (COL1a2) ELISA Kit
DLR-COL1a2-Mu-96T 96T
EUR 635
  • Should the Mouse Collagen Type I Alpha 2 (COL1a2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Collagen Type I Alpha 2 (COL1a2) in samples from serum, plasma or other biological fluids.

Rat Collagen Type I Alpha 2 (COL1a2) ELISA Kit
DLR-COL1a2-Ra-48T 48T
EUR 508
  • Should the Rat Collagen Type I Alpha 2 (COL1a2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Collagen Type I Alpha 2 (COL1a2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Collagen Type I Alpha 2 (COL1a2) ELISA Kit
DLR-COL1a2-Ra-96T 96T
EUR 661
  • Should the Rat Collagen Type I Alpha 2 (COL1a2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Collagen Type I Alpha 2 (COL1a2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rabbit Collagen Type I Alpha 2 (COL1a2) ELISA Kit
DLR-COL1a2-Rb-48T 48T
EUR 508
  • Should the Rabbit Collagen Type I Alpha 2 (COL1a2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit Collagen Type I Alpha 2 (COL1a2) in samples from serum, plasma or other biological fluids.

Rabbit Collagen Type I Alpha 2 (COL1a2) ELISA Kit
DLR-COL1a2-Rb-96T 96T
EUR 661
  • Should the Rabbit Collagen Type I Alpha 2 (COL1a2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit Collagen Type I Alpha 2 (COL1a2) in samples from serum, plasma or other biological fluids.

Bovine Collagen Type I Alpha 2 (COL1a2) ELISA Kit
RDR-COL1a2-b-48Tests 48 Tests
EUR 580

Bovine Collagen Type I Alpha 2 (COL1a2) ELISA Kit
RDR-COL1a2-b-96Tests 96 Tests
EUR 807

Canine Collagen Type I Alpha 2 (COL1a2) ELISA Kit
RDR-COL1a2-c-48Tests 48 Tests
EUR 557

Canine Collagen Type I Alpha 2 (COL1a2) ELISA Kit
RDR-COL1a2-c-96Tests 96 Tests
EUR 774

Human Collagen Type I Alpha 2 (COL1a2) ELISA Kit
RDR-COL1a2-Hu-48Tests 48 Tests
EUR 500

Human Collagen Type I Alpha 2 (COL1a2) ELISA Kit
RDR-COL1a2-Hu-96Tests 96 Tests
EUR 692

Mouse Collagen Type I Alpha 2 (COL1a2) ELISA Kit
RDR-COL1a2-Mu-48Tests 48 Tests
EUR 511

Mouse Collagen Type I Alpha 2 (COL1a2) ELISA Kit
RDR-COL1a2-Mu-96Tests 96 Tests
EUR 709

Rat Collagen Type I Alpha 2 (COL1a2) ELISA Kit
RDR-COL1a2-Ra-48Tests 48 Tests
EUR 534

Rat Collagen Type I Alpha 2 (COL1a2) ELISA Kit
RDR-COL1a2-Ra-96Tests 96 Tests
EUR 742

Rabbit Collagen Type I Alpha 2 (COL1a2) ELISA Kit
RDR-COL1a2-Rb-48Tests 48 Tests
EUR 534

Rabbit Collagen Type I Alpha 2 (COL1a2) ELISA Kit
RDR-COL1a2-Rb-96Tests 96 Tests
EUR 742

Bovine Collagen Type I Alpha 2 (COL1a2) ELISA Kit
RD-COL1a2-b-48Tests 48 Tests
EUR 555

Bovine Collagen Type I Alpha 2 (COL1a2) ELISA Kit
RD-COL1a2-b-96Tests 96 Tests
EUR 771

Canine Collagen Type I Alpha 2 (COL1a2) ELISA Kit
RD-COL1a2-c-48Tests 48 Tests
EUR 533

Canine Collagen Type I Alpha 2 (COL1a2) ELISA Kit
RD-COL1a2-c-96Tests 96 Tests
EUR 740

Human Collagen Type I Alpha 2 (COL1a2) ELISA Kit
RD-COL1a2-Hu-48Tests 48 Tests
EUR 478

Human Collagen Type I Alpha 2 (COL1a2) ELISA Kit
RD-COL1a2-Hu-96Tests 96 Tests
EUR 662

Mouse Collagen Type I Alpha 2 (COL1a2) ELISA Kit
RD-COL1a2-Mu-48Tests 48 Tests
EUR 489

Mouse Collagen Type I Alpha 2 (COL1a2) ELISA Kit
RD-COL1a2-Mu-96Tests 96 Tests
EUR 677

Rat Collagen Type I Alpha 2 (COL1a2) ELISA Kit
RD-COL1a2-Ra-48Tests 48 Tests
EUR 511

Rat Collagen Type I Alpha 2 (COL1a2) ELISA Kit
RD-COL1a2-Ra-96Tests 96 Tests
EUR 709

Rabbit Collagen Type I Alpha 2 (COL1a2) ELISA Kit
RD-COL1a2-Rb-48Tests 48 Tests
EUR 511

Rabbit Collagen Type I Alpha 2 (COL1a2) ELISA Kit
RD-COL1a2-Rb-96Tests 96 Tests
EUR 709

COL1a2/ Rat COL1a2 ELISA Kit
ELA-E2570r 96 Tests
EUR 886

Col1a2/ Rat Col1a2 ELISA Kit
ELI-33673r 96 Tests
EUR 886

COL1A2 antibody
70R-16497 50 ul
EUR 435
Description: Rabbit polyclonal COL1A2 antibody

COL1A2 antibody
70R-31222 100 ug
EUR 327
Description: Rabbit polyclonal COL1A2 antibody

COL1A2 Antibody
35634-100ul 100ul
EUR 252

COL1A2 Antibody
1-CSB-PA005728GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against COL1A2. Recognizes COL1A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

COL1A2 Antibody
1-CSB-PA001742
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against COL1A2. Recognizes COL1A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

COL1A2 Antibody
1-CSB-PA001743
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against COL1A2. Recognizes COL1A2 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

COL1A2 Antibody
CSB-PA571805-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against COL1A2. Recognizes COL1A2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

COL1A2 Antibody
CSB-PA571805-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against COL1A2. Recognizes COL1A2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

COL1A2 Antibody
1-CSB-PA182143
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against COL1A2. Recognizes COL1A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:100-1:300

COL1A2 Antibody
1-CSB-PA201854
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against COL1A2. Recognizes COL1A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

COL1A2 Antibody
1-CSB-PA225534
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against COL1A2. Recognizes COL1A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000

COL1A2 antibody
70R-49569 100 ul
EUR 244
Description: Purified Polyclonal COL1A2 antibody

COL1A2 antibody
70R-49570 100 ul
EUR 454
Description: Purified Polyclonal COL1A2 antibody

COL1A2 siRNA
20-abx901176
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

COL1A2 siRNA
20-abx912408
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

COL1A2 siRNA
20-abx912409
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

COL1A2 Polyclonal Antibody
40771-100ul 100ul
EUR 252

COL1A2 Polyclonal Antibody
40771-50ul 50ul
EUR 187

COL1A2/COL1A1 Antibody
1-CSB-PA164287
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against COL1A2/COL1A1. Recognizes COL1A2/COL1A1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000

Anti-COL1A2 Antibody
A00624-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for COL1A2 Antibody (COL1A2) detection.tested for WB in Human, Mouse, Rat.

COL1A2 Blocking Peptide
20-abx061969
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

COL1A2 Blocking Peptide
20-abx062444
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

COL1A2 Blocking Peptide
20-abx062445
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

COL1A2 Conjugated Antibody
C35634 100ul
EUR 397

COL1A2 / COL1A1 Antibody
20-abx329798
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

COL1A2 cloning plasmid
CSB-CL005728HU-10ug 10ug
EUR 1612
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 4101
  • Sequence: atgctcagctttgtggatacgcggactttgttgctgcttgcagtaaccttatgcctagcaacatgccaatctttacaagaggaaactgtaagaaagggcccagccggagatagaggaccacgtggagaaaggggtccaccaggccccccaggcagagatggtgaagatggtccca
  • Show more
Description: A cloning plasmid for the COL1A2 gene.

COL1A2 Polyclonal Antibody
ABP51021-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human COL1A2 at AA range: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of COL1A2 from Human, Mouse, Rat. This COL1A2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human COL1A2 at AA range: 1-80

COL1A2 Polyclonal Antibody
ABP51021-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human COL1A2 at AA range: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of COL1A2 from Human, Mouse, Rat. This COL1A2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human COL1A2 at AA range: 1-80

COL1A2 Polyclonal Antibody
ABP51021-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human COL1A2 at AA range: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of COL1A2 from Human, Mouse, Rat. This COL1A2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human COL1A2 at AA range: 1-80

COL1A2 Polyclonal Antibody
ABP51022-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human COL1A2 at AA range: 440-520
  • Applications tips:
Description: A polyclonal antibody for detection of COL1A2 from Human. This COL1A2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human COL1A2 at AA range: 440-520

COL1A2 Polyclonal Antibody
ABP51022-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human COL1A2 at AA range: 440-520
  • Applications tips:
Description: A polyclonal antibody for detection of COL1A2 from Human. This COL1A2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human COL1A2 at AA range: 440-520

COL1A2 Polyclonal Antibody
ABP51022-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human COL1A2 at AA range: 440-520
  • Applications tips:
Description: A polyclonal antibody for detection of COL1A2 from Human. This COL1A2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human COL1A2 at AA range: 440-520

COL1A2 Rabbit pAb
A5786-100ul 100 ul
EUR 308

COL1A2 Rabbit pAb
A5786-200ul 200 ul
EUR 459

COL1A2 Rabbit pAb
A5786-20ul 20 ul
EUR 183

COL1A2 Rabbit pAb
A5786-50ul 50 ul
EUR 223

COL1A2 Rabbit pAb
A16699-100ul 100 ul
EUR 308

COL1A2 Rabbit pAb
A16699-200ul 200 ul
EUR 459

COL1A2 Rabbit pAb
A16699-20ul 20 ul
EUR 183

COL1A2 Rabbit pAb
A16699-50ul 50 ul
EUR 223

COL1A2 Polyclonal Antibody
ES2020-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against COL1A2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

COL1A2 Polyclonal Antibody
ES2020-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against COL1A2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

COL1A2 Polyclonal Antibody
ES2021-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against COL1A2 from Human. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

COL1A2 Polyclonal Antibody
ES2021-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against COL1A2 from Human. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

Anti-COL1A2 antibody
STJ28351 100 µl
EUR 277
Description: This gene encodes the pro-alpha2 chain of type I collagen whose triple helix comprises two alpha1 chains and one alpha2 chain. Type I is a fibril-forming collagen found in most connective tissues and is abundant in bone, cornea, dermis and tendon. Mutations in this gene are associated with osteogenesis imperfecta types I-IV, Ehlers-Danlos syndrome type VIIB, recessive Ehlers-Danlos syndrome Classical type, idiopathic osteoporosis, and atypical Marfan syndrome. Symptoms associated with mutations in this gene, however, tend to be less severe than mutations in the gene for the alpha1 chain of type I collagen (COL1A1) reflecting the different role of alpha2 chains in matrix integrity. Three transcripts, resulting from the use of alternate polyadenylation signals, have been identified for this gene.

Anti-COL1A2 antibody
STJ119121 100 µl
EUR 277

Anti-COL1A2 antibody
STJ92383 200 µl
EUR 197
Description: COL1A2 is a protein encoded by the COL1A2 gene which is approximately 129,3 kDa. COL1A2 is secreted into the extracellular space. It is involved in collagen chain trimerization, the integrin pathway, ERK signalling and focal adhesion. It is a pro-alpha-2 chain of type I collagen whose triple helix comprises two alpha-1 chains and one alpha-2 chain. COL1A2 is expressed in tendons, ligaments and bones. Mutations in the COL1A2 gene may result in Ehlers-Danlos syndrome and osteogenesis imperfecta. STJ92383 was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen. This polyclonal antibody detects endogenous levels of COL1A2 protein.

Anti-COL1A2 antibody
STJ92384 200 µl
EUR 197
Description: Rabbit polyclonal to COL1A2.

Anti-COL1A2 (7E11)
YF-MA12496 100 ug
EUR 363
Description: Mouse monoclonal to COL1A2

Recombinant Collagen Type I Alpha 2 (COL1a2)
4-RPA215Ca01
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O46392
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 60.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Dog Collagen Type I Alpha 2 expressed in: E.coli

Recombinant Collagen Type I Alpha 2 (COL1a2)
4-RPA215Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P08123
  • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.4kDa
  • Isoelectric Point: 5.4
Description: Recombinant Human Collagen Type I Alpha 2 expressed in: E.coli

Recombinant Collagen Type I Alpha 2 (COL1a2)
4-RPA215Mu01
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q01149
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.0kDa
  • Isoelectric Point: 6.2
Description: Recombinant Mouse Collagen Type I Alpha 2 expressed in: E.coli

cDNA Synthesis SuperMix
20-abx09801420ulSystems
  • EUR 565.00
  • EUR 481.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

Evo? cDNA Kit
M1164-100
EUR 294

Evo? cDNA Kit
M1164-25
EUR 234

Novo? cDNA Kit
M1165-100
EUR 354

Novo? cDNA Kit
M1165-25
EUR 267

Evo? cDNA Supermix
M1168-100
EUR 381

Evo? cDNA Supermix
M1168-25
EUR 267

Novo? cDNA Supermix
M1169-100
EUR 441

Novo? cDNA Supermix
M1169-25
EUR 289

Cleaved-COL1A2 (G1102) Antibody
1-CSB-PA000039
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Cleaved-COL1A2 (G1102). Recognizes Cleaved-COL1A2 (G1102) from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

COL1A2 (Cleaved-Gly1102) Antibody
20-abx015578
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Human COL1a2 ELISA Kit
EHC0329 96Tests
EUR 521

Canine COL1a2 ELISA Kit
ELA-E2570d 96 Tests
EUR 928

Goat COL1a2 ELISA Kit
EGTC0329 96Tests
EUR 521

Bovine COL1a2 ELISA Kit
EBC0329 96Tests
EUR 521

Canine COL1a2 ELISA Kit
ECC0329 96Tests
EUR 521

Chicken COL1a2 ELISA Kit
ECKC0329 96Tests
EUR 521

Anserini COL1a2 ELISA Kit
EAC0329 96Tests
EUR 521

Canine COL1A2 ELISA KIT
ELI-51021d 96 Tests
EUR 928

Rat COL1A2 shRNA Plasmid
20-abx986911
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse COL1A2 shRNA Plasmid
20-abx969768
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human COL1A2 shRNA Plasmid
20-abx950894
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse COL1a2 ELISA Kit
EMC0329 96Tests
EUR 521

Rat COL1a2 ELISA Kit
ERC0329 96Tests
EUR 521

Sheep COL1a2 ELISA Kit
ESC0329 96Tests
EUR 521

Rabbit COL1a2 ELISA Kit
ERTC0329 96Tests
EUR 521

Monkey COL1a2 ELISA Kit
EMKC0329 96Tests
EUR 521

Porcine COL1a2 ELISA Kit
EPC0329 96Tests
EUR 521

cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis
C1634310 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Corn
C1634330 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Orange
C1634340 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Potato
C1634350 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Rice
C1634360 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Wheat
C1634390 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Collagen Type I Alpha 2 (COL1a2) Polyclonal Antibody (Dog)
4-PAA215Ca01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: COL1a2 (Gly1057~Leu1339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Collagen Type I Alpha 2 (COL1a2)

Collagen Type I Alpha 2 (COL1a2) Polyclonal Antibody (Mouse)
4-PAA215Mu01
  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: COL1a2 (Val1109~Lys1372)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Collagen Type I Alpha 2 (COL1a2)

Cattle Collagen Type I Alpha 2 (COL1a2) ELISA Kit
SEA215Bo-10x96wellstestplate 10x96-wells test plate
EUR 5098.02
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Collagen Type I Alpha 2 (COL1a2) in serum, plasma and other biological fluids.

Cattle Collagen Type I Alpha 2 (COL1a2) ELISA Kit
SEA215Bo-1x48wellstestplate 1x48-wells test plate
EUR 507.48
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Collagen Type I Alpha 2 (COL1a2) in serum, plasma and other biological fluids.

Cattle Collagen Type I Alpha 2 (COL1a2) ELISA Kit
SEA215Bo-1x96wellstestplate 1x96-wells test plate
EUR 682.12
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Collagen Type I Alpha 2 (COL1a2) in serum, plasma and other biological fluids.

Cattle Collagen Type I Alpha 2 (COL1a2) ELISA Kit
SEA215Bo-5x96wellstestplate 5x96-wells test plate
EUR 2769.54
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Collagen Type I Alpha 2 (COL1a2) in serum, plasma and other biological fluids.

Cattle Collagen Type I Alpha 2 (COL1a2) ELISA Kit
4-SEA215Bo
  • EUR 5149.00
  • EUR 2720.00
  • EUR 683.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Collagen Type I Alpha 2 elisa. Alternative names of the recognized antigen: COL1-A2
  • OI4
  • Collagen Alpha-2(I)chain
  • osteogenesis imperfecta type IV
  • Collagen Of Skin, Tendon And bone, Alpha-2 Chain
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Cattle Collagen Type I Alpha 2 (COL1a2) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Dog Collagen Type I Alpha 2 (COL1a2) ELISA Kit
SEA215Ca-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Dog Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Dog Collagen Type I Alpha 2 (COL1a2) in serum, plasma and other biological fluids.

Dog Collagen Type I Alpha 2 (COL1a2) ELISA Kit
SEA215Ca-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Dog Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Dog Collagen Type I Alpha 2 (COL1a2) in serum, plasma and other biological fluids.

Dog Collagen Type I Alpha 2 (COL1a2) ELISA Kit
SEA215Ca-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Dog Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Dog Collagen Type I Alpha 2 (COL1a2) in serum, plasma and other biological fluids.

Dog Collagen Type I Alpha 2 (COL1a2) ELISA Kit
SEA215Ca-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Dog Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Dog Collagen Type I Alpha 2 (COL1a2) in serum, plasma and other biological fluids.

Dog Collagen Type I Alpha 2 (COL1a2) ELISA Kit
4-SEA215Ca
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Collagen Type I Alpha 2 elisa. Alternative names of the recognized antigen: COL1-A2
  • OI4
  • Collagen Alpha-2(I)chain
  • osteogenesis imperfecta type IV
  • Collagen Of Skin, Tendon And bone, Alpha-2 Chain
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Dog Collagen Type I Alpha 2 (COL1a2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Collagen Type I Alpha 2 (COL1a2) ELISA Kit
SEA215Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Collagen Type I Alpha 2 (COL1a2) in serum, plasma, tissue homogenates and other biological fluids.

Human Collagen Type I Alpha 2 (COL1a2) ELISA Kit
SEA215Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Collagen Type I Alpha 2 (COL1a2) in serum, plasma, tissue homogenates and other biological fluids.

Human Collagen Type I Alpha 2 (COL1a2) ELISA Kit
SEA215Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Collagen Type I Alpha 2 (COL1a2) in serum, plasma, tissue homogenates and other biological fluids.

Human Collagen Type I Alpha 2 (COL1a2) ELISA Kit
SEA215Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Collagen Type I Alpha 2 (COL1a2) in serum, plasma, tissue homogenates and other biological fluids.

Human Collagen Type I Alpha 2 (COL1a2) ELISA Kit
4-SEA215Hu
  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Collagen Type I Alpha 2 elisa. Alternative names of the recognized antigen: COL1-A2
  • OI4
  • Collagen Alpha-2(I)chain
  • osteogenesis imperfecta type IV
  • Collagen Of Skin, Tendon And bone, Alpha-2 Chain
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Collagen Type I Alpha 2 (COL1a2) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Collagen Type I Alpha 2 (COL1a2) ELISA Kit
SEA215Mu-10x96wellstestplate 10x96-wells test plate
EUR 4391.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Collagen Type I Alpha 2 (COL1a2) in serum, plasma and other biological fluids.

Mouse Collagen Type I Alpha 2 (COL1a2) ELISA Kit
SEA215Mu-1x48wellstestplate 1x48-wells test plate
EUR 449.27
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Collagen Type I Alpha 2 (COL1a2) in serum, plasma and other biological fluids.

Mouse Collagen Type I Alpha 2 (COL1a2) ELISA Kit
SEA215Mu-1x96wellstestplate 1x96-wells test plate
EUR 598.96
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Collagen Type I Alpha 2 (COL1a2) in serum, plasma and other biological fluids.

Mouse Collagen Type I Alpha 2 (COL1a2) ELISA Kit
SEA215Mu-5x96wellstestplate 5x96-wells test plate
EUR 2395.32
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Collagen Type I Alpha 2 (COL1a2) in serum, plasma and other biological fluids.

Mouse Collagen Type I Alpha 2 (COL1a2) ELISA Kit
4-SEA215Mu
  • EUR 4442.00
  • EUR 2346.00
  • EUR 599.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Collagen Type I Alpha 2 elisa. Alternative names of the recognized antigen: COL1-A2
  • OI4
  • Collagen Alpha-2(I)chain
  • osteogenesis imperfecta type IV
  • Collagen Of Skin, Tendon And bone, Alpha-2 Chain
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Collagen Type I Alpha 2 (COL1a2) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Collagen Type I Alpha 2 (COL1a2) ELISA Kit
SEA215Ra-10x96wellstestplate 10x96-wells test plate
EUR 4626.78
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Collagen Type I Alpha 2 (COL1a2) in serum, plasma, tissue homogenates and other biological fluids.

Rat Collagen Type I Alpha 2 (COL1a2) ELISA Kit
SEA215Ra-1x48wellstestplate 1x48-wells test plate
EUR 468.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Collagen Type I Alpha 2 (COL1a2) in serum, plasma, tissue homogenates and other biological fluids.

Rat Collagen Type I Alpha 2 (COL1a2) ELISA Kit
SEA215Ra-1x96wellstestplate 1x96-wells test plate
EUR 626.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Collagen Type I Alpha 2 (COL1a2) in serum, plasma, tissue homogenates and other biological fluids.

Rat Collagen Type I Alpha 2 (COL1a2) ELISA Kit
SEA215Ra-5x96wellstestplate 5x96-wells test plate
EUR 2520.06
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Collagen Type I Alpha 2 (COL1a2) in serum, plasma, tissue homogenates and other biological fluids.

Rat Collagen Type I Alpha 2 (COL1a2) ELISA Kit
4-SEA215Ra
  • EUR 4677.00
  • EUR 2471.00
  • EUR 627.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Collagen Type I Alpha 2 elisa. Alternative names of the recognized antigen: COL1-A2
  • OI4
  • Collagen Alpha-2(I)chain
  • osteogenesis imperfecta type IV
  • Collagen Of Skin, Tendon And bone, Alpha-2 Chain
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Collagen Type I Alpha 2 (COL1a2) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rabbit Collagen Type I Alpha 2 (COL1a2) ELISA Kit
SEA215Rb-10x96wellstestplate 10x96-wells test plate
EUR 4626.78
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rabbit Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rabbit Collagen Type I Alpha 2 (COL1a2) in serum, plasma and other biological fluids.

Rabbit Collagen Type I Alpha 2 (COL1a2) ELISA Kit
SEA215Rb-1x48wellstestplate 1x48-wells test plate
EUR 468.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rabbit Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rabbit Collagen Type I Alpha 2 (COL1a2) in serum, plasma and other biological fluids.

Rabbit Collagen Type I Alpha 2 (COL1a2) ELISA Kit
SEA215Rb-1x96wellstestplate 1x96-wells test plate
EUR 626.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rabbit Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rabbit Collagen Type I Alpha 2 (COL1a2) in serum, plasma and other biological fluids.

Rabbit Collagen Type I Alpha 2 (COL1a2) ELISA Kit
SEA215Rb-5x96wellstestplate 5x96-wells test plate
EUR 2520.06
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rabbit Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rabbit Collagen Type I Alpha 2 (COL1a2) in serum, plasma and other biological fluids.

Rabbit Collagen Type I Alpha 2 (COL1a2) ELISA Kit
4-SEA215Rb
  • EUR 4677.00
  • EUR 2471.00
  • EUR 627.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Collagen Type I Alpha 2 elisa. Alternative names of the recognized antigen: COL1-A2
  • OI4
  • Collagen Alpha-2(I)chain
  • osteogenesis imperfecta type IV
  • Collagen Of Skin, Tendon And bone, Alpha-2 Chain
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rabbit Collagen Type I Alpha 2 (COL1a2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)
20-abx09801620ulSystems
  • EUR 620.00
  • EUR 523.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)
20-abx09802120ulSystems
  • EUR 871.00
  • EUR 662.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean
C1634370 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
These strategies are extra time efficient than conventional strategies and take solely an hour to finish. To our information, that is the primary report on the strategy of isolation of high-quality RNA for cDNA synthesis in addition to isolation of the calmodulin gene sequence from this fungus.

Leave a Comment