With the emergence of RNA sequencing applied sciences, metatranscriptomic research are quickly gaining consideration as they concurrently present perception into gene expression profiles and subsequently illness affiliation pathways of microbial pathogens and their hosts. This strategy, subsequently, holds promise for applicability in infectious illness diagnostics.
A problem of this strategy within the scientific setting is the low quantity and high quality of RNA, particularly microbial RNA in most clinically-infected specimens. Right here, we in contrast two commercially accessible stranded cDNA library preparation kits, the NuGEN Ovation SoLo RNA-Seq System and the Illumina TruSeq Stranded Complete RNA, utilizing RNA extracted from synovial and sonicate fluids from a topic with periprosthetic joint an infection. The Ovation SoLo RNA-Seq System supplied extra helpful transcriptomic information for the infecting bacterium, whereas the TruSeq Stranded Complete RNA equipment supplied extra helpful human transcriptomic information.
PacBio full-length cDNA sequencing built-in with RNA-seq reads drastically improves the invention of splicing transcripts in rice.
In eukaryotes, various splicing (AS) vastly expands the variety of transcripts. Nevertheless, it’s difficult to precisely decide full-length splicing isoforms. Just lately, extra research have taken benefit of Pacific Bioscience (PacBio) long-read sequencing to establish full-length transcripts. Nonetheless, the excessive error fee of PacBio reads significantly offsets some great benefits of lengthy reads, particularly for precisely figuring out splicing junctions. To finest capitalize on the options of lengthy reads, we used Illumina RNA-seq reads to enhance PacBio round consensus sequence (CCS) high quality and to validate splicing patterns within the rice transcriptome.
We evaluated the influence of CCS accuracy on the quantity and the validation fee of splicing isoforms, and built-in a complete pipeline of splicing transcripts evaluation by Iso-Seq and RNA-seq (STAIR) to establish the full-length multi-exon isoforms in rice seedling transcriptome (Oryza sativa L. ssp. japonica). STAIR found 11 733 full-length multi-exon isoforms, 6599 greater than the SMRT Portal RS_IsoSeq pipeline did.
Of those splicing isoforms recognized, 4453 (37.9%) have been missed in assembled transcripts from RNA-seq reads, and 5204 (44.4%), together with 268 multi-exon lengthy non-coding RNAs (lncRNAs), weren’t reported within the MSU_osa1r7 annotation. Some randomly chosen unreported splicing junctions have been verified by polymerase chain response (PCR) amplification.

As well as, we investigated various polyadenylation (APA) occasions in transcripts and recognized 829 main polyadenylation [poly(A)] web site clusters (PACs). The evaluation of splicing isoforms and APA occasions will facilitate the annotation of the rice genome and research on the expression and polyadenylation of AS genes in numerous developmental phases or progress situations of rice.
An RNA Binding Peptide Consisting of 4 Varieties of Amino Acid by in Vitro Choice Utilizing cDNA Show.
RNA-protein interactions have a central function within the residing world. On this article, we examined whether or not primitive peptides (30 residues) consisting of 4 kinds of amino acid (Gly, Ala, Asp, and Val) might work together with tRNA as a mannequin of primitive RNAs within the RNA world. By in vitro choice of binding peptides utilizing the cDNA show methodology, a attribute peptide was chosen from a random peptide library and assayed by electrophoretic mobility shift and pull-down assays. Curiously, the chosen peptide certain to a single-stranded area together with a loop construction of an RNA molecule with some sequence specificity.
Comparability of varied RNA extraction strategies, cDNA preparation and isolation of calmodulin gene from a extremely melanized isolate of apple leaf blotch fungus Marssonina coronaria.
Marssonina coronaria causes apple blotch illness leading to extreme untimely defoliation, and is distributed in lots of main apple-growing areas on the planet. Efficient, dependable and high-quality RNA extraction is an indispensable process in any molecular biology examine. No methodology presently exists for RNA extraction from M. coronaria that produces a excessive amount of melanin-free RNA.
Subsequently, we evaluated eight RNA extraction strategies together with handbook and industrial kits, to yield a ample amount of high-quality and melanin-free RNA. Guide strategies used right here resulted in low high quality and black coloured RNA pellets exhibiting the presence of melanin, regardless of all of the modifications employed to authentic procedures. Nevertheless, these strategies when coupled with clear up resulted in melanin-free RNA.
Alternatively, all industrial kits used have been in a position to yield high-quality melanin-free RNA having variable yields. TRIzol™ Reagent + RNA Clear & Concentrator™-5 and Ambion-PureLink® RNA Mini Package have been discovered to be the perfect strategies because the RNA extracted with these strategies from 15 day previous fungal tradition grown on strong medium have been freed from melanin with good yield. RNA extracted by this improved methodology was utilized for RT-PCR, subsequent PCR amplification, and isolation of calmodulin gene sequences from M. coronaria and contaminated apple leaf items.
Canine Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
DLR-COL1a2-c-96T |
DL Develop |
96T |
EUR 688 |
- Should the Canine Collagen Type I Alpha 2 (COL1a2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Canine Collagen Type I Alpha 2 (COL1a2) in samples from serum, plasma or other biological fluids. |
Human Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
DLR-COL1a2-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Collagen Type I Alpha 2 (COL1a2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Collagen Type I Alpha 2 (COL1a2) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
DLR-COL1a2-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Collagen Type I Alpha 2 (COL1a2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Collagen Type I Alpha 2 (COL1a2) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
DLR-COL1a2-Mu-48T |
DL Develop |
48T |
EUR 489 |
- Should the Mouse Collagen Type I Alpha 2 (COL1a2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Collagen Type I Alpha 2 (COL1a2) in samples from serum, plasma or other biological fluids. |
Mouse Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
DLR-COL1a2-Mu-96T |
DL Develop |
96T |
EUR 635 |
- Should the Mouse Collagen Type I Alpha 2 (COL1a2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Collagen Type I Alpha 2 (COL1a2) in samples from serum, plasma or other biological fluids. |
Rat Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
DLR-COL1a2-Ra-48T |
DL Develop |
48T |
EUR 508 |
- Should the Rat Collagen Type I Alpha 2 (COL1a2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Collagen Type I Alpha 2 (COL1a2) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Rat Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
DLR-COL1a2-Ra-96T |
DL Develop |
96T |
EUR 661 |
- Should the Rat Collagen Type I Alpha 2 (COL1a2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Collagen Type I Alpha 2 (COL1a2) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Rabbit Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
DLR-COL1a2-Rb-48T |
DL Develop |
48T |
EUR 508 |
- Should the Rabbit Collagen Type I Alpha 2 (COL1a2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit Collagen Type I Alpha 2 (COL1a2) in samples from serum, plasma or other biological fluids. |
Rabbit Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
DLR-COL1a2-Rb-96T |
DL Develop |
96T |
EUR 661 |
- Should the Rabbit Collagen Type I Alpha 2 (COL1a2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit Collagen Type I Alpha 2 (COL1a2) in samples from serum, plasma or other biological fluids. |
Bovine Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
RDR-COL1a2-b-48Tests |
Reddot Biotech |
48 Tests |
EUR 580 |
Bovine Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
RDR-COL1a2-b-96Tests |
Reddot Biotech |
96 Tests |
EUR 807 |
Canine Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
RDR-COL1a2-c-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Canine Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
RDR-COL1a2-c-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Human Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
RDR-COL1a2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
RDR-COL1a2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Mouse Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
RDR-COL1a2-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
RDR-COL1a2-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Rat Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
RDR-COL1a2-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Rat Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
RDR-COL1a2-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
Rabbit Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
RDR-COL1a2-Rb-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Rabbit Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
RDR-COL1a2-Rb-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
Bovine Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
RD-COL1a2-b-48Tests |
Reddot Biotech |
48 Tests |
EUR 555 |
Bovine Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
RD-COL1a2-b-96Tests |
Reddot Biotech |
96 Tests |
EUR 771 |
Canine Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
RD-COL1a2-c-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Canine Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
RD-COL1a2-c-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Human Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
RD-COL1a2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
RD-COL1a2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Mouse Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
RD-COL1a2-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 489 |
Mouse Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
RD-COL1a2-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 677 |
Rat Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
RD-COL1a2-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Rat Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
RD-COL1a2-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Rabbit Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
RD-COL1a2-Rb-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Rabbit Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
RD-COL1a2-Rb-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
COL1A2 antibody |
70R-16497 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal COL1A2 antibody |
COL1A2 antibody |
70R-31222 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal COL1A2 antibody |
COL1A2 Antibody |
35634-100ul |
SAB |
100ul |
EUR 252 |
COL1A2 Antibody |
1-CSB-PA005728GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against COL1A2. Recognizes COL1A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
COL1A2 Antibody |
1-CSB-PA001742 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against COL1A2. Recognizes COL1A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000 |
COL1A2 Antibody |
1-CSB-PA001743 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against COL1A2. Recognizes COL1A2 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000 |
COL1A2 Antibody |
CSB-PA571805- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against COL1A2. Recognizes COL1A2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500 |
COL1A2 Antibody |
CSB-PA571805-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against COL1A2. Recognizes COL1A2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500 |
COL1A2 Antibody |
1-CSB-PA182143 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against COL1A2. Recognizes COL1A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:100-1:300 |
COL1A2 Antibody |
1-CSB-PA201854 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against COL1A2. Recognizes COL1A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
COL1A2 Antibody |
1-CSB-PA225534 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against COL1A2. Recognizes COL1A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000 |
COL1A2 antibody |
70R-49569 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal COL1A2 antibody |
COL1A2 antibody |
70R-49570 |
Fitzgerald |
100 ul |
EUR 454 |
Description: Purified Polyclonal COL1A2 antibody |
COL1A2 siRNA |
20-abx901176 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
COL1A2 siRNA |
20-abx912408 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
COL1A2 siRNA |
20-abx912409 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
COL1A2 Polyclonal Antibody |
40771-100ul |
SAB |
100ul |
EUR 252 |
COL1A2 Polyclonal Antibody |
40771-50ul |
SAB |
50ul |
EUR 187 |
COL1A2/COL1A1 Antibody |
1-CSB-PA164287 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against COL1A2/COL1A1. Recognizes COL1A2/COL1A1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000 |
Anti-COL1A2 Antibody |
A00624-1 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal Antibody for COL1A2 Antibody (COL1A2) detection.tested for WB in Human, Mouse, Rat. |
COL1A2 Blocking Peptide |
20-abx061969 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
COL1A2 Blocking Peptide |
20-abx062444 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
COL1A2 Blocking Peptide |
20-abx062445 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
COL1A2 Conjugated Antibody |
C35634 |
SAB |
100ul |
EUR 397 |
COL1A2 / COL1A1 Antibody |
20-abx329798 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
COL1A2 cloning plasmid |
CSB-CL005728HU-10ug |
Cusabio |
10ug |
EUR 1612 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 4101
- Sequence: atgctcagctttgtggatacgcggactttgttgctgcttgcagtaaccttatgcctagcaacatgccaatctttacaagaggaaactgtaagaaagggcccagccggagatagaggaccacgtggagaaaggggtccaccaggccccccaggcagagatggtgaagatggtccca
- Show more
|
Description: A cloning plasmid for the COL1A2 gene. |
COL1A2 Polyclonal Antibody |
ABP51021-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the N-terminal region of human COL1A2 at AA range: 1-80
- Applications tips:
|
Description: A polyclonal antibody for detection of COL1A2 from Human, Mouse, Rat. This COL1A2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human COL1A2 at AA range: 1-80 |
COL1A2 Polyclonal Antibody |
ABP51021-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the N-terminal region of human COL1A2 at AA range: 1-80
- Applications tips:
|
Description: A polyclonal antibody for detection of COL1A2 from Human, Mouse, Rat. This COL1A2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human COL1A2 at AA range: 1-80 |
COL1A2 Polyclonal Antibody |
ABP51021-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the N-terminal region of human COL1A2 at AA range: 1-80
- Applications tips:
|
Description: A polyclonal antibody for detection of COL1A2 from Human, Mouse, Rat. This COL1A2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human COL1A2 at AA range: 1-80 |
COL1A2 Polyclonal Antibody |
ABP51022-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the Internal region of human COL1A2 at AA range: 440-520
- Applications tips:
|
Description: A polyclonal antibody for detection of COL1A2 from Human. This COL1A2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human COL1A2 at AA range: 440-520 |
COL1A2 Polyclonal Antibody |
ABP51022-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human COL1A2 at AA range: 440-520
- Applications tips:
|
Description: A polyclonal antibody for detection of COL1A2 from Human. This COL1A2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human COL1A2 at AA range: 440-520 |
COL1A2 Polyclonal Antibody |
ABP51022-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human COL1A2 at AA range: 440-520
- Applications tips:
|
Description: A polyclonal antibody for detection of COL1A2 from Human. This COL1A2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human COL1A2 at AA range: 440-520 |
COL1A2 Rabbit pAb |
A5786-100ul |
Abclonal |
100 ul |
EUR 308 |
COL1A2 Rabbit pAb |
A5786-200ul |
Abclonal |
200 ul |
EUR 459 |
COL1A2 Rabbit pAb |
A5786-20ul |
Abclonal |
20 ul |
EUR 183 |
COL1A2 Rabbit pAb |
A5786-50ul |
Abclonal |
50 ul |
EUR 223 |
COL1A2 Rabbit pAb |
A16699-100ul |
Abclonal |
100 ul |
EUR 308 |
COL1A2 Rabbit pAb |
A16699-200ul |
Abclonal |
200 ul |
EUR 459 |
COL1A2 Rabbit pAb |
A16699-20ul |
Abclonal |
20 ul |
EUR 183 |
COL1A2 Rabbit pAb |
A16699-50ul |
Abclonal |
50 ul |
EUR 223 |
COL1A2 Polyclonal Antibody |
ES2020-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against COL1A2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
COL1A2 Polyclonal Antibody |
ES2020-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against COL1A2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
COL1A2 Polyclonal Antibody |
ES2021-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against COL1A2 from Human. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
COL1A2 Polyclonal Antibody |
ES2021-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against COL1A2 from Human. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
Anti-COL1A2 antibody |
STJ28351 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes the pro-alpha2 chain of type I collagen whose triple helix comprises two alpha1 chains and one alpha2 chain. Type I is a fibril-forming collagen found in most connective tissues and is abundant in bone, cornea, dermis and tendon. Mutations in this gene are associated with osteogenesis imperfecta types I-IV, Ehlers-Danlos syndrome type VIIB, recessive Ehlers-Danlos syndrome Classical type, idiopathic osteoporosis, and atypical Marfan syndrome. Symptoms associated with mutations in this gene, however, tend to be less severe than mutations in the gene for the alpha1 chain of type I collagen (COL1A1) reflecting the different role of alpha2 chains in matrix integrity. Three transcripts, resulting from the use of alternate polyadenylation signals, have been identified for this gene. |
Anti-COL1A2 antibody |
STJ92383 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: COL1A2 is a protein encoded by the COL1A2 gene which is approximately 129,3 kDa. COL1A2 is secreted into the extracellular space. It is involved in collagen chain trimerization, the integrin pathway, ERK signalling and focal adhesion. It is a pro-alpha-2 chain of type I collagen whose triple helix comprises two alpha-1 chains and one alpha-2 chain. COL1A2 is expressed in tendons, ligaments and bones. Mutations in the COL1A2 gene may result in Ehlers-Danlos syndrome and osteogenesis imperfecta. STJ92383 was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen. This polyclonal antibody detects endogenous levels of COL1A2 protein. |
Anti-COL1A2 antibody |
STJ92384 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to COL1A2. |
Anti-COL1A2 (7E11) |
YF-MA12496 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to COL1A2 |
Recombinant Collagen Type I Alpha 2 (COL1a2) |
4-RPA215Ca01 |
Cloud-Clone |
-
EUR 530.08
-
EUR 245.00
-
EUR 1712.80
-
EUR 637.60
-
EUR 1175.20
-
EUR 418.00
-
EUR 4132.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O46392
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 60.9kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Dog Collagen Type I Alpha 2 expressed in: E.coli |
Recombinant Collagen Type I Alpha 2 (COL1a2) |
4-RPA215Hu01 |
Cloud-Clone |
-
EUR 467.36
-
EUR 228.00
-
EUR 1477.60
-
EUR 559.20
-
EUR 1018.40
-
EUR 376.00
-
EUR 3544.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P08123
- Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 33.4kDa
- Isoelectric Point: 5.4
|
Description: Recombinant Human Collagen Type I Alpha 2 expressed in: E.coli |
Recombinant Collagen Type I Alpha 2 (COL1a2) |
4-RPA215Mu01 |
Cloud-Clone |
-
EUR 440.48
-
EUR 221.00
-
EUR 1376.80
-
EUR 525.60
-
EUR 951.20
-
EUR 358.00
-
EUR 3292.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q01149
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 33.0kDa
- Isoelectric Point: 6.2
|
Description: Recombinant Mouse Collagen Type I Alpha 2 expressed in: E.coli |
cDNA Synthesis SuperMix |
20-abx09801420ulSystems |
Abbexa |
|
-
100 rxns × 20 ul Systems
-
50 rxns × 20 ul Systems
|
- Shipped within 5-10 working days.
|
Evo? cDNA Supermix |
M1168-100 |
Biovision |
|
EUR 381 |
Evo? cDNA Supermix |
M1168-25 |
Biovision |
|
EUR 267 |
Novo? cDNA Supermix |
M1169-100 |
Biovision |
|
EUR 441 |
Novo? cDNA Supermix |
M1169-25 |
Biovision |
|
EUR 289 |
Cleaved-COL1A2 (G1102) Antibody |
1-CSB-PA000039 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against Cleaved-COL1A2 (G1102). Recognizes Cleaved-COL1A2 (G1102) from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000 |
COL1A2 (Cleaved-Gly1102) Antibody |
20-abx015578 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Human COL1a2 ELISA Kit |
EHC0329 |
Abclonal |
96Tests |
EUR 521 |
Goat COL1a2 ELISA Kit |
EGTC0329 |
Abclonal |
96Tests |
EUR 521 |
Bovine COL1a2 ELISA Kit |
EBC0329 |
Abclonal |
96Tests |
EUR 521 |
Canine COL1a2 ELISA Kit |
ECC0329 |
Abclonal |
96Tests |
EUR 521 |
Chicken COL1a2 ELISA Kit |
ECKC0329 |
Abclonal |
96Tests |
EUR 521 |
Anserini COL1a2 ELISA Kit |
EAC0329 |
Abclonal |
96Tests |
EUR 521 |
Rat COL1A2 shRNA Plasmid |
20-abx986911 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse COL1A2 shRNA Plasmid |
20-abx969768 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human COL1A2 shRNA Plasmid |
20-abx950894 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse COL1a2 ELISA Kit |
EMC0329 |
Abclonal |
96Tests |
EUR 521 |
Rat COL1a2 ELISA Kit |
ERC0329 |
Abclonal |
96Tests |
EUR 521 |
Sheep COL1a2 ELISA Kit |
ESC0329 |
Abclonal |
96Tests |
EUR 521 |
Rabbit COL1a2 ELISA Kit |
ERTC0329 |
Abclonal |
96Tests |
EUR 521 |
Monkey COL1a2 ELISA Kit |
EMKC0329 |
Abclonal |
96Tests |
EUR 521 |
Porcine COL1a2 ELISA Kit |
EPC0329 |
Abclonal |
96Tests |
EUR 521 |
cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis |
C1634310 |
Biochain |
40 reactions |
EUR 621 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Corn |
C1634330 |
Biochain |
40 reactions |
EUR 621 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Orange |
C1634340 |
Biochain |
40 reactions |
EUR 621 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Potato |
C1634350 |
Biochain |
40 reactions |
EUR 621 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Rice |
C1634360 |
Biochain |
40 reactions |
EUR 621 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Wheat |
C1634390 |
Biochain |
40 reactions |
EUR 621 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
Collagen Type I Alpha 2 (COL1a2) Polyclonal Antibody (Dog) |
4-PAA215Ca01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: COL1a2 (Gly1057~Leu1339)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Dog Collagen Type I Alpha 2 (COL1a2) |
Collagen Type I Alpha 2 (COL1a2) Polyclonal Antibody (Mouse) |
4-PAA215Mu01 |
Cloud-Clone |
-
EUR 236.00
-
EUR 2338.00
-
EUR 586.00
-
EUR 294.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: COL1a2 (Val1109~Lys1372)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Collagen Type I Alpha 2 (COL1a2) |
Cattle Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
SEA215Bo-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5098.02 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Collagen Type I Alpha 2 (COL1a2) in serum, plasma and other biological fluids. |
Cattle Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
SEA215Bo-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 507.48 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Collagen Type I Alpha 2 (COL1a2) in serum, plasma and other biological fluids. |
Cattle Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
SEA215Bo-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 682.12 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Collagen Type I Alpha 2 (COL1a2) in serum, plasma and other biological fluids. |
Cattle Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
SEA215Bo-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2769.54 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Collagen Type I Alpha 2 (COL1a2) in serum, plasma and other biological fluids. |
Cattle Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
4-SEA215Bo |
Cloud-Clone |
-
EUR 5149.00
-
EUR 2720.00
-
EUR 683.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Collagen Type I Alpha 2 elisa. Alternative names of the recognized antigen: COL1-A2
- OI4
- Collagen Alpha-2(I)chain
- osteogenesis imperfecta type IV
- Collagen Of Skin, Tendon And bone, Alpha-2 Chain
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Cattle Collagen Type I Alpha 2 (COL1a2) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species. |
Dog Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
SEA215Ca-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Dog Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Dog Collagen Type I Alpha 2 (COL1a2) in serum, plasma and other biological fluids. |
Dog Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
SEA215Ca-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Dog Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Dog Collagen Type I Alpha 2 (COL1a2) in serum, plasma and other biological fluids. |
Dog Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
SEA215Ca-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Dog Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Dog Collagen Type I Alpha 2 (COL1a2) in serum, plasma and other biological fluids. |
Dog Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
SEA215Ca-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Dog Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Dog Collagen Type I Alpha 2 (COL1a2) in serum, plasma and other biological fluids. |
Dog Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
4-SEA215Ca |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Collagen Type I Alpha 2 elisa. Alternative names of the recognized antigen: COL1-A2
- OI4
- Collagen Alpha-2(I)chain
- osteogenesis imperfecta type IV
- Collagen Of Skin, Tendon And bone, Alpha-2 Chain
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Dog Collagen Type I Alpha 2 (COL1a2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
SEA215Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4273.35 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Collagen Type I Alpha 2 (COL1a2) in serum, plasma, tissue homogenates and other biological fluids. |
Human Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
SEA215Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 439.57 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Collagen Type I Alpha 2 (COL1a2) in serum, plasma, tissue homogenates and other biological fluids. |
Human Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
SEA215Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 585.1 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Collagen Type I Alpha 2 (COL1a2) in serum, plasma, tissue homogenates and other biological fluids. |
Human Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
SEA215Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2332.95 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Collagen Type I Alpha 2 (COL1a2) in serum, plasma, tissue homogenates and other biological fluids. |
Human Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
4-SEA215Hu |
Cloud-Clone |
-
EUR 4324.00
-
EUR 2283.00
-
EUR 586.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Collagen Type I Alpha 2 elisa. Alternative names of the recognized antigen: COL1-A2
- OI4
- Collagen Alpha-2(I)chain
- osteogenesis imperfecta type IV
- Collagen Of Skin, Tendon And bone, Alpha-2 Chain
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Collagen Type I Alpha 2 (COL1a2) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
SEA215Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4391.16 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Collagen Type I Alpha 2 (COL1a2) in serum, plasma and other biological fluids. |
Mouse Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
SEA215Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 449.27 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Collagen Type I Alpha 2 (COL1a2) in serum, plasma and other biological fluids. |
Mouse Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
SEA215Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 598.96 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Collagen Type I Alpha 2 (COL1a2) in serum, plasma and other biological fluids. |
Mouse Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
SEA215Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2395.32 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Collagen Type I Alpha 2 (COL1a2) in serum, plasma and other biological fluids. |
Mouse Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
4-SEA215Mu |
Cloud-Clone |
-
EUR 4442.00
-
EUR 2346.00
-
EUR 599.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Collagen Type I Alpha 2 elisa. Alternative names of the recognized antigen: COL1-A2
- OI4
- Collagen Alpha-2(I)chain
- osteogenesis imperfecta type IV
- Collagen Of Skin, Tendon And bone, Alpha-2 Chain
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Collagen Type I Alpha 2 (COL1a2) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species. |
Rat Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
SEA215Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4626.78 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Collagen Type I Alpha 2 (COL1a2) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
SEA215Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 468.68 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Collagen Type I Alpha 2 (COL1a2) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
SEA215Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 626.68 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Collagen Type I Alpha 2 (COL1a2) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
SEA215Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2520.06 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Collagen Type I Alpha 2 (COL1a2) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
4-SEA215Ra |
Cloud-Clone |
-
EUR 4677.00
-
EUR 2471.00
-
EUR 627.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Collagen Type I Alpha 2 elisa. Alternative names of the recognized antigen: COL1-A2
- OI4
- Collagen Alpha-2(I)chain
- osteogenesis imperfecta type IV
- Collagen Of Skin, Tendon And bone, Alpha-2 Chain
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Collagen Type I Alpha 2 (COL1a2) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Rabbit Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
SEA215Rb-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4626.78 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rabbit Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rabbit Collagen Type I Alpha 2 (COL1a2) in serum, plasma and other biological fluids. |
Rabbit Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
SEA215Rb-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 468.68 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rabbit Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rabbit Collagen Type I Alpha 2 (COL1a2) in serum, plasma and other biological fluids. |
Rabbit Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
SEA215Rb-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 626.68 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rabbit Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rabbit Collagen Type I Alpha 2 (COL1a2) in serum, plasma and other biological fluids. |
Rabbit Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
SEA215Rb-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2520.06 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rabbit Collagen Type I Alpha 2 (COL1a2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rabbit Collagen Type I Alpha 2 (COL1a2) in serum, plasma and other biological fluids. |
Rabbit Collagen Type I Alpha 2 (COL1a2) ELISA Kit |
4-SEA215Rb |
Cloud-Clone |
-
EUR 4677.00
-
EUR 2471.00
-
EUR 627.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Collagen Type I Alpha 2 elisa. Alternative names of the recognized antigen: COL1-A2
- OI4
- Collagen Alpha-2(I)chain
- osteogenesis imperfecta type IV
- Collagen Of Skin, Tendon And bone, Alpha-2 Chain
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rabbit Collagen Type I Alpha 2 (COL1a2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species. |
First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb) |
20-abx09801620ulSystems |
Abbexa |
|
-
100 rxns × 20 ul Systems
-
50 rxns × 20 ul Systems
|
- Shipped within 5-10 working days.
|
First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb) |
20-abx09802120ulSystems |
Abbexa |
|
-
100 rxns × 20 ul Systems
-
50 rxns × 20 ul Systems
|
- Shipped within 5-10 working days.
|
cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean |
C1634370 |
Biochain |
40 reactions |
EUR 621 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
These strategies are extra time efficient than conventional strategies and take solely an hour to finish. To our information, that is the primary report on the strategy of isolation of high-quality RNA for cDNA synthesis in addition to isolation of the calmodulin gene sequence from this fungus.
Leave a Comment